IL13RA1-interleukin 13 receptor, alpha 1 Gene View larger

IL13RA1-interleukin 13 receptor, alpha 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL13RA1-interleukin 13 receptor, alpha 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IL13RA1-interleukin 13 receptor, alpha 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015768
Product type: DNA & cDNA
Ncbi symbol: IL13RA1
Origin species: Human
Product name: IL13RA1-interleukin 13 receptor, alpha 1 Gene
Size: 2ug
Accessions: BC015768
Gene id: 3597
Gene description: interleukin 13 receptor, alpha 1
Synonyms: CD213A1; CT19; IL-13Ra; NR4; interleukin-13 receptor subunit alpha-1; CD213a1 antigen; IL-13 receptor subunit alpha-1; IL-13R subunit alpha-1; IL13 receptor alpha-1 chain; cancer/testis antigen 19; interleukin 13 receptor, alpha 1; interleukin 13 receptor subunit alpha 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtgtccggcgcggctctgcgggctgtgggcgctgctgctctgcgccggcggcgggggcgggggcgggggcgccgcgcctacggaaactcagccacctgtgacaaatttgagtgtctctgttgaaaacctctgcacagtaatatggacatggaatccacccgagggagccagctcaaattgtagtctatggtattttagtcattttggcgacaaacaagataagaaaatagctccggaaactcgtcgttcaatagaagtacccctgaatgagaggatttgtctgcaagtggggtcccagtgtagcaccaatgagagtgagaagcctagcattttggttgaaaaatgcatctcacccccagaaggtgatcctgagtctgctgtgactgagcttcaatgcatttggcacaacctgagctacatgaagtgttcttggctccctggaaggaataccagtcccgacactaactatactctctactattggcacagaagcctggaaaaaattcatcaatgtgaaaacatctttagagaaggccaatactttggttgttcctttgatctgaccaaagtgaaggattccagttttgaacaacacagtgtccaaataatggtcaaggataatgcaggaaaaattaaaccatccttcaatatagtgcctttaacttcccgtgtgaaacctgatcctccacatattaaaaacctctccttccacaatgatgacctatatgtgcaatgggagaatccacagaattttattagcagatgcctattttatgaagtagaagtcaataacagccaaactgagacacataatgttttctacgtccaagaggctaaatgtgagaatccagaatttgagagaaatgtggagaatacatcttgtttcatggtccctggtgttcttcctgatactttgaacacagtcagaataagagtcaaaacaaataagttatgctatgaggatgacaaactctggagtaattggagccaagaaatgagtataggtaagaagcgcaattccacactctacataaccatgttactcattgttccagtcatcgtcgcaggtgcaatcatagtactcctgctttacctaaaaaggctcaagattattatattccctccaattcctgatcctggcaagatttttaaagaaatgtttggagaccagaatgatgatactctgcactggaagaagtacgacatctatgagaagcaaaccaaggaggaaaccgactctgtagtgctgatagaaaacctgaagaaagcctctcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sphingosine-1-phosphate receptor 4
- hexosaminidase B (beta polypeptide)
- ribonuclease/angiogenin inhibitor 1
- chromosome 1 open reading frame 2

Buy IL13RA1-interleukin 13 receptor, alpha 1 Gene now

Add to cart