S1PR4-sphingosine-1-phosphate receptor 4 Gene View larger

S1PR4-sphingosine-1-phosphate receptor 4 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S1PR4-sphingosine-1-phosphate receptor 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about S1PR4-sphingosine-1-phosphate receptor 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014970
Product type: DNA & cDNA
Ncbi symbol: S1PR4
Origin species: Human
Product name: S1PR4-sphingosine-1-phosphate receptor 4 Gene
Size: 2ug
Accessions: BC014970
Gene id: 8698
Gene description: sphingosine-1-phosphate receptor 4
Synonyms: EDG6; LPC1; S1P4; SLP4; sphingosine 1-phosphate receptor 4; S1P receptor 4; S1P receptor Edg-6; endothelial differentiation G-protein coupled receptor 6; endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6; sphingosine 1-phosphate receptor Edg-6; sphingosine-1-phosphate receptor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgccacggggaccccggtggcccccgagtcctgccaacagctggcggccggcgggcacagccggctcattgttctgcactacaaccactcgggccggctggccgggcgcggggggccggaggatggcggcctgggggccctgcgggggctgtcggtggccgccagctgcctggtggtgctggagaacttgctggtgctggcggccatcaccagccacatgcggtcgcgacgctgggtctactattgcctggtgaacatcacgctgagtgacctgctcacgggcgcggcctacctggccaacgtgctgctgtcgggggcccgcaccttccgtctggcgcccgcccagtggttcctacgggagggcctgctcttcaccgccctggccgcctccaccttcagcctgctcttcactgcaggggagcgctttgccaccatggtgcggccggtggccgagagcggggccaccaagaccagccgcgtctacggcttcatcggcctctgctggctgctggccgcgctgctggggatgctgcctttgctgggctggaactgcctgtgcgcctttgaccgctgctccagccttctgcccctctactccaagcgctacatcctcttctgcctggtgatcttcgccggcgtcctggccaccatcatgggcctctatggggccatcttccgcctggtgcaggccagcgggcagaaggccccacgcccagcggcccgccgcaaggcccgccgcctgctgaagacggtgctgatgatcctgctggccttcctggtgtgctggggcccactcttcgggctgctgctggccgacgtctttggctccaacctctgggcccaggagtacctgcggggcatggactggatcctggccctggccgtcctcaactcggcggtcaaccccatcatctactccttccgcagcagggaggtgtgcagagccgtgctcagcttcctctgctgcgggtgtctccggctgggcatgcgagggcccggggactgcctggcccgggccgtcgaggctcactccggagcttccaccaccgacagctctctgaggccaagggacagctttcgcggctcccgctcgctcagctttcggatgcgggagcccctgtccagcatctccagcgtgcggagcatctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hexosaminidase B (beta polypeptide)
- ribonuclease/angiogenin inhibitor 1
- chromosome 1 open reading frame 2
- ring finger protein (C3H2C3 type) 6

Buy S1PR4-sphingosine-1-phosphate receptor 4 Gene now

Add to cart