Login to display prices
Login to display prices
FBF1-Fas (TNFRSF6) binding factor 1 Gene View larger

FBF1-Fas (TNFRSF6) binding factor 1 Gene

PTXBC012332

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FBF1-Fas (TNFRSF6) binding factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FBF1-Fas (TNFRSF6) binding factor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012332
Product type: DNA & cDNA
Ncbi symbol: FBF1
Origin species: Human
Product name: FBF1-Fas (TNFRSF6) binding factor 1 Gene
Size: 2ug
Accessions: BC012332
Gene id: 85302
Gene description: Fas (TNFRSF6) binding factor 1
Synonyms: Alb; FBF-1; fas-binding factor 1; Fas (TNFRSF6) binding factor 1; Fas binding protein 1; albatross; protein albatross; Fas binding factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcggctccgggagctgcagcgggcgtccatcctagacatgcgcagagaccacgaggagcagctgcagcggctaaagctgctgaaggaccgagaggtcgatgcggccaccagtgccacctcccacacgcggtccctgaatagcatcatccaccagatggagaagttctccagcagcctgcacgagttgtcctcccgcgtggaggcctcgcacctcaccacctcccaggagcgggagctggggatccggcagcgtgacgagcagctgcgggcactgcaggagcggctgggccagcagcagcgggacatggaggaggagcggagccggcaacaggaggtcatcgggaagatggaggcacggctgaatgagcagagccggctgctggagcaggaacgctggcgggtgactgccgagcagtccaaggcggagtccatgcagcgcgccctagaggagcaaaggaaggtcacggcccagcagatggccatggaaagggcggagctggaacgggccaagagcgccttgctggaggagcagaagtctgtcatgctcaagtgcggggaggagcggcggcgcctggctgccgagtgggcggagttctccgcgcagcaaaagctgagtaaggagcgggccgagcgcgaggccgagcgggcattgcaggtggacacccagcgggagggcaccctcatcagcctggccaaggagcaggctgagctgaagatcagggccagcgagctccgggccgaggagaagcagctggcagcggagagagcagccctggagcaggagcggcaggagctgcggctggagaaggagaggatcaacgccaccgccctgcgtgtcaagctccgcgccgaggaggtggagagcatgagcaaggtggcctccgagaagtacgaggagggggagcgggcattgcgcgaggcccagcaggtgcaggcagagcagcaggcccggttgcaggcggtgcagcaacagcaggagcggctgcggaagcaggagcagcacatgcaccaggagcatctgagtctggcccagcagaggctgcaactggaccgcgcacgacaggacctgccctctagcctcgtgggtctgttccccagggcccagggccctgcagcctccagccagagtgccctcatgcctcctgctcccaccacccgttggtgcagccagccgccaactggcctggaccccagccccttgcacctccatgccaggctggcactgctgaggcacatggcagagcaggaccgtgacttcttggagaatgaacagttcttcctggagaccctgaagaaagggtcctacaatttgacatctcattcagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family B, 4
- transmembrane protein 184A
- kaptin (actin binding protein)
- PTK2 protein tyrosine kinase 2