Login to display prices
Login to display prices
TMEM184A-transmembrane protein 184A Gene View larger

TMEM184A-transmembrane protein 184A Gene

PTXBC026694

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM184A-transmembrane protein 184A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM184A-transmembrane protein 184A Gene

Proteogenix catalog: PTXBC026694
Ncbi symbol: TMEM184A
Product name: TMEM184A-transmembrane protein 184A Gene
Size: 2ug
Accessions: BC026694
Gene id: 202915
Gene description: transmembrane protein 184A
Synonyms: SDMG1; transmembrane protein 184A; sexually dimorphic, expressed in male gonads 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtaatgtctcagggatcctggagacagccggcgtccccctggtgtcagtgaactggccgcagcccagccccccaccggctgtgccagctgggccgcagatggaccacatggggaacagctcccagggggccccctggctcttcctcacctccgcactggcccgaggcgtctcggggatcttcgtgtggactgccctggtgctcacctgccaccagatctatctgcacctgcgctcctacaccgtgccacaggagcaacgttacatcatccgcctgctcctcatcgtgcccatctacgccttcgactcctggctcagcctcctcctcctcggagaccaccagtactacgtctacttcgactctgtgcgggactgctacgaagcctttgtcatttacagcttcctgagcctgtgtttccagtacctgggaggcgagggcgccatcatggctgagattcgtggaaagcccatcaagtccagctgcttgtacggcacctgctgcctccggggcatgacctactccatcgggttcctgcgcttctgtaagcaggccactctgcagttctgcctggtgaagcccgtcatggccgtcaccaccatcatcctccaggcatttggcaaataccacgacggggacttcaatgtccgcagcggctacctctatgtgaccctcatctacaacgcctccgtcagcctcgccctctacgccctgttcctcttctacttcaccaccagggagctcctgcggcccttccagcccgtcctcaagttcctcaccatcaaagccgtcatcttcctgtcgttctggcaagggctgctgctggccatcctggagcggtgcggggtcatcccggaggtggagaccagcggcgggaacaagctgggggctggcacgctggccgccggctaccagaacttcatcatctgcgtggagatgctgttcgcctccgtggccctgcgttatgccttcccctgccaggtgtacgcagagaagaaggagaattcaccagcccccccggcacccatgcagagcatctccagcggcatcagggagacagtgagcccccaggacatcgtgcaggacgccatccacaacttctcccccgcctaccagcactacacgcagcaggccacgcacgaggcgcccaggcccggcacccaccccggcggcggcggctccggcgggagcaggaagagccggagcctggagaagcggatgctgatcccctcggaggacctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: