MAGEB4-melanoma antigen family B, 4 Gene View larger

MAGEB4-melanoma antigen family B, 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEB4-melanoma antigen family B, 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEB4-melanoma antigen family B, 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032852
Product type: DNA & cDNA
Ncbi symbol: MAGEB4
Origin species: Human
Product name: MAGEB4-melanoma antigen family B, 4 Gene
Size: 2ug
Accessions: BC032852
Gene id: 4115
Gene description: melanoma antigen family B, 4
Synonyms: CT3.6; melanoma-associated antigen B4; MAGE-B4 antigen; cancer/testis antigen family 3, member 6; melanoma antigen family B, 4; melanoma antigen family B4; MAGE family member B4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcggggtcagaagagtaagctccgtgcccgtgagaaacgccagcggacccgtggtcagacccaggatctcaaggttggtcagcctactgcagcagagaaagaagagtctccttccccttcctcatctgttttgagggatactgcctccagctcccttgcttttggcattccccaggagcctcagagagagccacccaccacctctgctgctgcagctatgtcatgcactggatctgataaaggcgacgagagccaagatgaggaaaatgcaagttcctcccaggcctcaacatccactgagagatcactcaaagattctctaaccaggaagacgaagatgttagtgcagttcctgctgtacaagtataaaatgaaagagcccactacaaaggcagaaatgctgaagatcatcagcaaaaagtacaaggagcacttccctgagatcttcaggaaagtctctcagcgcacggagctggtctttggccttgccttgaaggaggtcaaccccaccactcactcctacatcctcgtcagcatgctaggccccaactatggaaaccagagcagtgcctggacccttccaaggaatgggcttctgatgcctctactgagtgtgatcttcttaaatggcaactgtgcccgtgaagaggaaatctgggaattcctgaatatgctggggatctatgatggaaagaggcaccttatctttggggaaccccgaaagctcatcacccaagatctggtgcaggaaaaatatctggaataccagcaggtgcccaacagtgatcccccacgctatcaattcctgtggggtccaagagctcatgcagaaaccagcaagatgaaagtcctggagtttttggccaaggtgaatgacaccacccccaataacttcccactcctttatgaagaggctttgagagatgaagaagagagagctggagcccggcccagagttgcagccaggcgtggcactacagccatgactagtgcgtattccagggccacatccagtagctcttcccaacccatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 184A
- kaptin (actin binding protein)
- PTK2 protein tyrosine kinase 2
- SH3-domain binding protein 1

Buy MAGEB4-melanoma antigen family B, 4 Gene now

Add to cart