Login to display prices
Login to display prices
MPG-N-methylpurine-DNA glycosylase Gene View larger

MPG-N-methylpurine-DNA glycosylase Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPG-N-methylpurine-DNA glycosylase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MPG-N-methylpurine-DNA glycosylase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014991
Product type: DNA & cDNA
Ncbi symbol: MPG
Origin species: Human
Product name: MPG-N-methylpurine-DNA glycosylase Gene
Size: 2ug
Accessions: BC014991
Gene id: 4350
Gene description: N-methylpurine-DNA glycosylase
Synonyms: N-methylpurine-DNA glycosylase, MPG; AAG; ADPG; APNG; CRA36.1; MDG; Mid1; PIG11; PIG16; anpg; DNA-3-methyladenine glycosylase; 3' end of the Mid1 gene, localized 68 kb upstream the humanzeta globin gene on 16p; 3-alkyladenine DNA glycosylase; 3-methyladenine DNA glycosidase; CRA36.1 (3-methyl-adenine DNA glycosylase); proliferation-inducing protein 11; proliferation-inducing protein 16; N-methylpurine DNA glycosylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccgcgcgcagcggggcccagttttgccgacggatggggcaaaagaagcagcgaccagctagagcagggcagccacacagctcgtccgacgcagcccaggcacctgcagagcagccacacagctcgtccgatgcagcccaggcaccttgccccagggagcgctgcttgggaccgcccaccactccgggcccataccgcagcatctatttctcaagcccaaagggccaccttacccgactggggttggagttcttcgaccagccggcagtccccctggcccgggcatttctgggacaggtcctagtccggcgacttcctaatggcacagaactccgaggccgcatcgtggagaccgaggcatacctggggccagaggatgaagccgcccactcaaggggtggccggcagaccccccgcaaccgaggcatgttcatgaagccggggaccctgtacgtgtacatcatttacggcatgtacttctgcatgaacatctccagccagggggacggggcttgcgtcttgctgcgagcactggagcccctggaaggtctggagaccatgcgtcagcttcgcagcaccctccggaaaggcaccgccagccgtgtcctcaaggaccgcgagctctgcagtggcccctccaagctgtgccaggccctggccatcaacaagagctttgaccagagggacctggcacaggatgaagctgtatggctggagcgtggtcccctggagcccagtgagccggctgtagtggcagcagcccgggtgggcgtcggccatgcaggggagtgggcccggaaacccctccgcttctatgtccggggcagcccctgggtcagtgtggtcgacagagtggctgagcaggacacacaggcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lines homolog 1 (Drosophila)
- H2A histone family, member Y
- RNA binding motif protein 42
- activin A receptor, type IC