PTXBC014991
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC014991 |
Product type: | DNA & cDNA |
Ncbi symbol: | MPG |
Origin species: | Human |
Product name: | MPG-N-methylpurine-DNA glycosylase Gene |
Size: | 2ug |
Accessions: | BC014991 |
Gene id: | 4350 |
Gene description: | N-methylpurine-DNA glycosylase |
Synonyms: | N-methylpurine-DNA glycosylase, MPG; AAG; ADPG; APNG; CRA36.1; MDG; Mid1; PIG11; PIG16; anpg; DNA-3-methyladenine glycosylase; 3' end of the Mid1 gene, localized 68 kb upstream the humanzeta globin gene on 16p; 3-alkyladenine DNA glycosylase; 3-methyladenine DNA glycosidase; CRA36.1 (3-methyl-adenine DNA glycosylase); proliferation-inducing protein 11; proliferation-inducing protein 16; N-methylpurine DNA glycosylase |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcccgcgcgcagcggggcccagttttgccgacggatggggcaaaagaagcagcgaccagctagagcagggcagccacacagctcgtccgacgcagcccaggcacctgcagagcagccacacagctcgtccgatgcagcccaggcaccttgccccagggagcgctgcttgggaccgcccaccactccgggcccataccgcagcatctatttctcaagcccaaagggccaccttacccgactggggttggagttcttcgaccagccggcagtccccctggcccgggcatttctgggacaggtcctagtccggcgacttcctaatggcacagaactccgaggccgcatcgtggagaccgaggcatacctggggccagaggatgaagccgcccactcaaggggtggccggcagaccccccgcaaccgaggcatgttcatgaagccggggaccctgtacgtgtacatcatttacggcatgtacttctgcatgaacatctccagccagggggacggggcttgcgtcttgctgcgagcactggagcccctggaaggtctggagaccatgcgtcagcttcgcagcaccctccggaaaggcaccgccagccgtgtcctcaaggaccgcgagctctgcagtggcccctccaagctgtgccaggccctggccatcaacaagagctttgaccagagggacctggcacaggatgaagctgtatggctggagcgtggtcccctggagcccagtgagccggctgtagtggcagcagcccgggtgggcgtcggccatgcaggggagtgggcccggaaacccctccgcttctatgtccggggcagcccctgggtcagtgtggtcgacagagtggctgagcaggacacacaggcctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - lines homolog 1 (Drosophila) - H2A histone family, member Y - RNA binding motif protein 42 - activin A receptor, type IC |