Cart 3 Product Products 887,00 € (empty)
No products
To be determined Shipping
887,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 887,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 887,00 €
Data sheet of MPG-N-methylpurine-DNA glycosylase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MPG-N-methylpurine-DNA glycosylase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014991 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MPG |
| Origin species: | Human |
| Product name: | MPG-N-methylpurine-DNA glycosylase Gene |
| Size: | 2ug |
| Accessions: | BC014991 |
| Gene id: | 4350 |
| Gene description: | N-methylpurine-DNA glycosylase |
| Synonyms: | N-methylpurine-DNA glycosylase, MPG; AAG; ADPG; APNG; CRA36.1; MDG; Mid1; PIG11; PIG16; anpg; DNA-3-methyladenine glycosylase; 3' end of the Mid1 gene, localized 68 kb upstream the humanzeta globin gene on 16p; 3-alkyladenine DNA glycosylase; 3-methyladenine DNA glycosidase; CRA36.1 (3-methyl-adenine DNA glycosylase); proliferation-inducing protein 11; proliferation-inducing protein 16; N-methylpurine DNA glycosylase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccgcgcgcagcggggcccagttttgccgacggatggggcaaaagaagcagcgaccagctagagcagggcagccacacagctcgtccgacgcagcccaggcacctgcagagcagccacacagctcgtccgatgcagcccaggcaccttgccccagggagcgctgcttgggaccgcccaccactccgggcccataccgcagcatctatttctcaagcccaaagggccaccttacccgactggggttggagttcttcgaccagccggcagtccccctggcccgggcatttctgggacaggtcctagtccggcgacttcctaatggcacagaactccgaggccgcatcgtggagaccgaggcatacctggggccagaggatgaagccgcccactcaaggggtggccggcagaccccccgcaaccgaggcatgttcatgaagccggggaccctgtacgtgtacatcatttacggcatgtacttctgcatgaacatctccagccagggggacggggcttgcgtcttgctgcgagcactggagcccctggaaggtctggagaccatgcgtcagcttcgcagcaccctccggaaaggcaccgccagccgtgtcctcaaggaccgcgagctctgcagtggcccctccaagctgtgccaggccctggccatcaacaagagctttgaccagagggacctggcacaggatgaagctgtatggctggagcgtggtcccctggagcccagtgagccggctgtagtggcagcagcccgggtgggcgtcggccatgcaggggagtgggcccggaaacccctccgcttctatgtccggggcagcccctgggtcagtgtggtcgacagagtggctgagcaggacacacaggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lines homolog 1 (Drosophila) - H2A histone family, member Y - RNA binding motif protein 42 - activin A receptor, type IC |