H2AFY-H2A histone family, member Y Gene View larger

H2AFY-H2A histone family, member Y Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of H2AFY-H2A histone family, member Y Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about H2AFY-H2A histone family, member Y Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013331
Product type: DNA & cDNA
Ncbi symbol: H2AFY
Origin species: Human
Product name: H2AFY-H2A histone family, member Y Gene
Size: 2ug
Accessions: BC013331
Gene id: 9555
Gene description: H2A histone family, member Y
Synonyms: H2A.y; H2A/y; H2AF12M; MACROH2A1.1; mH2A1; macroH2A1.2; core histone macro-H2A.1; histone H2A.y; histone macroH2A1; histone macroH2A1.1; histone macroH2A1.2; medulloblastoma antigen MU-MB-50.205; H2A histone family member Y
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgagccgcggtgggaagaagaagtccaccaagacgtccaggtctgccaaagcaggagtcatctttcccgtggggcggatgctgcggtacatcaagaaaggccaccccaagtacaggattggagtgggggcacccgtgtacatggccgccgtcctggaatacctgacagcggagattctggagctggctggcaatgcagcgagagacaacaagaagggacgggtcacaccccggcacatcctgctggctgtggccaatgatgaagagctgaatcagctgctaaaaggagtcaccatagccagtgggggtgtgttacccaacatccaccccgagttgctagcgaagaagcggggatccaaaggaaagttggaagccatcatcacaccacccccagccaaaaaggccaagtctccatcccagaagaagcctgtatctaaaaaagcaggaggcaagaaaggggcccggaaatccaagaagaagcagggtgaagtcagtaaggcagccagcgccgacagcacaaccgagggcacacctgccgacggcttcacagtcctctccaccaagagcctcttccttggccagaagctgaaccttattcacagtgaaatcagtaatttagccggctttgaggtggaggccataatcaatcctaccaatgctgacattgaccttaaagatgacctaggaaacacgctggagaagaaaggtggcaaggagtttgtggaagctgtcctggaactccggaaaaagaacgggcccttggaagtagctggagctgctgtcagcgcaggccatggcctgcctgccaagtttgtgatccactgtaatagtccagtttggggtgcagacaagtgtgaagaacttctggaaaagacagtgaaaaactgcttggccctggctgatgataagaagctgaaatccattgcatttccatccatcggcagcggcaggaacggttttccaaagcagacagcagctcagctgattctgaaggccatctccagttacttcgtgtctacaatgtcctcttccatcaaaacggtgtacttcgtgctttttgacagcgagagtataggcatctatgtgcaggaaatggccaagctggacgccaactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RNA binding motif protein 42
- activin A receptor, type IC
- phosphofructokinase, platelet
- fem-1 homolog c (C. elegans)

Buy H2AFY-H2A histone family, member Y Gene now

Add to cart