LINS1-lines homolog 1 (Drosophila) Gene View larger

LINS1-lines homolog 1 (Drosophila) Gene

PTXBC010363

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LINS1-lines homolog 1 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LINS1-lines homolog 1 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010363
Product type: DNA & cDNA
Ncbi symbol: LINS1
Origin species: Human
Product name: LINS1-lines homolog 1 (Drosophila) Gene
Size: 2ug
Accessions: BC010363
Gene id: 55180
Gene description: lines homolog 1 (Drosophila)
Synonyms: LINS; MRT27; protein Lines homolog 1; WINS1 protein with Drosophila Lines (Lin) homologous domain; wnt-signaling molecule Lines homolog 1; lines homolog 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagttttctgtgaagttttagaagagttatacaagaaggtacttcttggagccacacttgaaaatgacagccatgattacgtcttttatctcaacccagcagtttcagatcaagattgttctacagccacctccttagaatgggcaaacacctgtggtatccagggcaggcatcagcccatctctgttggtgtggctcccattgctgtagcacctgtgtgtttgaagaccaactctcagatgagcggttccagagaagtaatgctccttcagttaacagtgatcaaagtgatgacaacccggatattgtctgtcaaaaccgagttccatgcaaaggagcagtacagagatgtaattaaaattctcttagaatcagccaaagtcgattctaaattaatctgcatgttccaaaattcagataaattgttatctcacatggctgcacagtgccttgcattgcttctatatttccaattgagagaaaagataaccttaagtaattcctggattgctttttgccagaaaaatctttctgaatactctgagagtaataaagcaatatactgcctctggactcttacagcaataataaaagaaatctttaaagattcatgttcacagaaaacagaaattctaaagcagttcctgactcattttgacaccatttttgaagtgttttacaattccttattctctcagcattttgaaaactgccgggatacttctaaaatagtaaacatcctgatgtgtttcctggatttgcttgagcttctcatcgcctccagaatccacctgaagttacatttcacttgccagaggattttatttttgaaaccatcttgcatgctagaagttattacctggcctattcaggcttttgttaaaaggaaggtcatcatattcctcaaaaagtgccttctctgtaaagtgggtgaagacctctgtcgtggatctgtgcctgccttaatgccgccagaccatcatgtagcggtggacatgctggctttagctaatgctgttttgcaagctgtgaattcggggttgttgaagacactgtctgtttatgaaaaacattccttttttggaggtgatgaagttcaacctgaatgtgaacttatcactagcccagatcatgtgatccttagagcagcaagcttagttataatgaaatccttagaaatcaagtttcaaaattattcttcagcaagtgaaatgaaaggtaattctccaaactccttttgtatgcagtgtgtaattatttacttaagtacagtaattcataattatcaaatctcaggactagtttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - H2A histone family, member Y
- RNA binding motif protein 42
- activin A receptor, type IC
- phosphofructokinase, platelet

Buy LINS1-lines homolog 1 (Drosophila) Gene now

Add to cart