Cart 4 Product Products 993,07 € (empty)
-
-
-
1 x ASPRV1-asp...113,40 € -
No products
To be determined Shipping
993,07 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 993,07 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 993,07 €
Data sheet of TMEM59L-transmembrane protein 59-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM59L-transmembrane protein 59-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010446 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM59L |
| Origin species: | Human |
| Product name: | TMEM59L-transmembrane protein 59-like Gene |
| Size: | 2ug |
| Accessions: | BC010446 |
| Gene id: | 25789 |
| Gene description: | transmembrane protein 59-like |
| Synonyms: | C19orf4; transmembrane protein 59-like; brain-specific membrane-anchored protein; transmembrane protein 59 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgcggtggcgctgatgccaccgccgctgctgctgctgctgctgttggcgtcgccgcccgccgcctccgcgccgtccgcccgcgatcccttcgccccccagctcggggacacgcagaactgccagctgcggtgccgcgaccgcgacctcggcccgcagccctcgcaggcggggctggagggcgcctccgagtctccctatgacagagccgttctgatcagcgcttgcgagcgtggctgccgcctcttctccatctgccgatttgtggccagaagctccaagcccaatgccacccaaactgagtgtgaagcagcctgcgtggaagcctatgtgaaggaggcagagcagcaggcctgtagccacggctgctggagccagcccgcggagcctgagccggagcagaagagaaaggtcctggaggctccaagtggggccctctccctcttggacttgttttccaccctctgcaatgacctcgtcaactcagcccagggatttgtctcctccacctggacatactacttgcagactgacaatgggaaagtggtggtgtttcagactcagcccatagtggagagcctcggcttccaggggggccgtctgcagcgcgtggaggtgacctggcgaggctcccaccctgaagccctggaggtgcacgtggaccctgtaggccccctggacaaggtgaggaaggccaagatccgagtcaagaccagcagcaaggccaaggtggagtctgaagagccacaggacaatgacttcctcagttgcatgtcccggcgctcgggtctgcctcgctggatcctggcctgctgcctcttcctctccgtgctggtgatgctgtggctgagctgctccaccctggtgaccgcgcctggccagcacctcaagttccagcctctgaccctggagcagcacaagggcttcatgatggagcccgattggcccctgtacccgccgccgtcccacgcctgtgaggacagcctaccaccctacaagctgaagctggacctgaccaagctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tripartite motif-containing 44 - tripartite motif-containing 47 - actin, alpha 1, skeletal muscle - dystrobrevin binding protein 1 |