Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NAB2-NGFI-A binding protein 2 (EGR1 binding protein 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NAB2-NGFI-A binding protein 2 (EGR1 binding protein 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007756 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NAB2 |
| Origin species: | Human |
| Product name: | NAB2-NGFI-A binding protein 2 (EGR1 binding protein 2) Gene |
| Size: | 2ug |
| Accessions: | BC007756 |
| Gene id: | 4665 |
| Gene description: | NGFI-A binding protein 2 (EGR1 binding protein 2) |
| Synonyms: | MADER; NGFI-A-binding protein 2; EGR1 binding protein 2; melanoma-associated delayed early response protein; NGFI-A binding protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcacagagcgccttcccccacagccgagcagccgccgggcggaggggacagcgcccgccggaccctgcagcccagactcaagcccagtgcccgagccatggcactgcctcggacgctgggggagctgcagctgtaccgggtcctgcagcgcgccaacctcctttcctactatgagaccttcatccagcagggaggggacgacgtgcagcagctgtgtgaggcgggtgaggaggagtttctggagatcatggcacttgtgggcatggccaccaagcccctccatgtccggcgcctgcagaaggcactgagagagtgggccaccaatccagggctcttcagtcaaccagtgcctgctgttcccgtctccagcatcccgctcttcaagatctctgagactgcgggtacccggaaagggagcatgagcaatgggcatggcagcccaggggaaaaggcaggcagtgcccgcagttttagccccaagagcccccttgaacttggagagaagctatcaccactgcctgggggacctggggcaggggacccccggatctggccaggccggagcactccagagtcggacgttggggcaggaggagaagaggaggctggcagcaggtgggactgggggtggtccagaccgactggagccagagatggtacgccagcctgtctggggagagtctggatggacatttgcaggctgtggggtcatgtccaaggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear distribution gene C homolog (A. nidulans) - tRNA methyltransferase 6 homolog (S. cerevisiae) - transcription factor 25 (basic helix-loop-helix) - tumor necrosis factor, alpha-induced protein 6 |