Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TNFAIP6-tumor necrosis factor, alpha-induced protein 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFAIP6-tumor necrosis factor, alpha-induced protein 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030205 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFAIP6 |
| Origin species: | Human |
| Product name: | TNFAIP6-tumor necrosis factor, alpha-induced protein 6 Gene |
| Size: | 2ug |
| Accessions: | BC030205 |
| Gene id: | 7130 |
| Gene description: | tumor necrosis factor, alpha-induced protein 6 |
| Synonyms: | TSG-6; TSG6; tumor necrosis factor-inducible gene 6 protein; TNF-stimulated gene 6 protein; hyaluronate-binding protein; tumor necrosis factor alpha-inducible protein 6; tumor necrosis factor, alpha induced protein 6; tumor necrosis factor-stimulated gene-6 protein; TNF alpha induced protein 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcatcttaatttacttatttctcttgctatgggaagacactcaaggatggggattcaaggatggaatttttcataactccatatggcttgaacgagcagccggtgtgtaccacagagaagcacggtctggcaaatacaagctcacctacgcagaagctaaggcggtgtgtgaatttgaaggcggccatctcgcaacttacaagcagctagaggcagccagaaaaattggatttcatgtctgtgctgctggatggatggctaagggcagagttggataccccattgtgaagccagggcccaactgtggatttggaaaaactggcattattgattatggaatccgtctcaataggagtgaaagatgggatgcctattgctacaacccacacgcaaaggagtgtggtggcgtctttacagatccaaagcaaatttttaaatctccaggcttcccaaatgagtacgaagataaccaaatctgctactggcacattagactcaagtatggtcagcgtattcacctgagttttttagattttgaccttgaagatgacccaggttgcttggctgattatgttgaaatatatgacagttacgatgatgtccatggctttgtgggaagatactgtggagatgagcttccagatgacatcatcagtacaggaaatgtcatgaccttgaagtttctaagtgatgcttcagtgacagctggaggtttccaaatcaaatatgttgcaatggatcctgtatccaaatccagtcaaggaaaaaatacaagtactacttctactggaaataaaaactttttagctggaagatttagccacttataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Rap guanine nucleotide exchange factor (GEF) 4 - N-acetylated alpha-linked acidic dipeptidase 2 - bruno-like 5, RNA binding protein (Drosophila) - bruno-like 6, RNA binding protein (Drosophila) |