Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NUDC-nuclear distribution gene C homolog (A. nidulans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDC-nuclear distribution gene C homolog (A. nidulans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002399 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDC |
| Origin species: | Human |
| Product name: | NUDC-nuclear distribution gene C homolog (A. nidulans) Gene |
| Size: | 2ug |
| Accessions: | BC002399 |
| Gene id: | 10726 |
| Gene description: | nuclear distribution gene C homolog (A. nidulans) |
| Synonyms: | nudC nuclear distribution protein; nuclear migration protein nudC; HNUDC; MNUDC; NPD011; nuclear distribution C homolog; nuclear distribution gene C homolog; nuclear distribution protein C homolog; nuclear distribution C, dynein complex regulator |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcggagagcaggaggaggagcggttcgacggcatgttgctggccatggctcagcagcacgagggcggcgtgcaggagcttgtgaacaccttcttcagcttccttcgacgcaaaacagactttttcattggaggagaagaagggatggcagagaagcttatcacacagactttcagccaccacaatcagctggcacagaagacccggcgggagaagagagcccggcaggaggccgagcggcgggagaaggcggagcgggcggccagactggccaaggaagccaagtcagagacctcagggccccagatcaaggagctaactgatgaagaggcagagaggctgcagctagagattgaccagaaaaaggatgcagagaatcatgaggcccagctcaagaacggcagccttgactccccagggaagcaggatactgaggaagatgaggaggaagatgagaaggacaaaggaaaactgaagcccaacctaggcaacggggcagacctgcccaattaccgctggacccagaccctgtcggagctggacctggcggtccctttctgtgtgaacttccggctgaaagggaaggacatggtggtggacatccagcggcggcacctccgggtggggctcaaggggcagccagcgatcattgatggggagctctacaatgaagtgaaggtggaggagagctcgtggctcattgaggacggcaaggtggtgactgtgcatctggagaagatcaataagatggagtggtggagccgcttggtgtccagtgaccctgagatcaacaccaagaagattaaccctgagaattccaagctgtcagacctggacagtgagactcgcagcatggtggaaaagatgatgtatgaccagcgacagaagtccatggggctgccaacttcagacgaacagaagaaacaggagattctgaagaagttcatggatcaacatccggagatggatttttccaaggctaaattcaactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tRNA methyltransferase 6 homolog (S. cerevisiae) - transcription factor 25 (basic helix-loop-helix) - tumor necrosis factor, alpha-induced protein 6 - Rap guanine nucleotide exchange factor (GEF) 4 |