Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001728 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TFPT |
| Origin species: | Human |
| Product name: | TFPT-TCF3 (E2A) fusion partner (in childhood Leukemia) Gene |
| Size: | 2ug |
| Accessions: | BC001728 |
| Gene id: | 29844 |
| Gene description: | TCF3 (E2A) fusion partner (in childhood Leukemia) |
| Synonyms: | FB1; INO80F; amida; TCF3 fusion partner; INO80 complex subunit F; TCF3 (E2A) fusion partner (in childhood Leukemia); amida, partner of the E2A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccgggagcgagatgaagaggaagaggcagcccggggtcggcggcggcgccagcgggaattaaatcgcagaaagtaccaggcactaggtcggcgctgccgggagatcgagcaggtgaacgagcgggtcctgaacaggctccatcaggtgcagaggataactcggaggctgcagcaggaacggaggttcctcatgagagtgctggactcctacggggatgactaccgggccagccagttcaccattgtgctggaggatgagggcagccagggcacggatgcccccaccccaggcaatgcggagaatgagcctccagagaaagagacactgtccccgcccagaaggactcctgcacccccagaacccggcagcccagcccccggtgaggggcccagtgggcggaagaggcggcgagtgccacgggatggacgccgagcaggaaatgcgctgactccagagctggccccggtgcagattaaggttgaggaagactttggctttgaagcagatgaggccctggattccagttgggtttctcggggtccagacaaactgctgccctacccgaccctggccagcccagcctctgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NGFI-A binding protein 2 (EGR1 binding protein 2) - nuclear distribution gene C homolog (A. nidulans) - tRNA methyltransferase 6 homolog (S. cerevisiae) - transcription factor 25 (basic helix-loop-helix) |