Cart 13 Product Products 2 042,24 € (empty)
-
-
-
-
-
1 x EPHA7-EPH...121,50 € -
-
1 x GC-group-s...121,50 € -
-
-
1 x NT5C3-5'-n...121,50 € -
-
-
No products
To be determined Shipping
2 042,24 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 042,24 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 042,24 €
Data sheet of CRH-corticotropin releasing hormone Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRH-corticotropin releasing hormone Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011031 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRH |
| Origin species: | Human |
| Product name: | CRH-corticotropin releasing hormone Gene |
| Size: | 2ug |
| Accessions: | BC011031 |
| Gene id: | 1392 |
| Gene description: | corticotropin releasing hormone |
| Synonyms: | CRF; CRH1; corticoliberin; corticotropin-releasing factor; corticotropin releasing hormone |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcggctgccgctgcttgtgtccgcgggagtcctgctggtggctctcctgccctgcccgccatgcagggcgctcctgagccgcgggccggtcccgggagctcggcaggcgccgcagcaccctcagcccttggatttcttccagccgccgccgcagtccgagcagccccagcagccgcaggctcggccggtcctgctccgcatgggagaggagtacttcctccgcctggggaacctcaacaagagcccggccgctcccctttcgcccgcctcctcgctcctcgccggcggcagcggcagccgcccttcgccggaacaggcgaccgccaactttttccgcgtgttgctgcagcagctgctgctgcctcggcgctcgctcgacagccccgcggctctcgcggagcgcggcgctaggaatgccctcggcggccaccaggaggcaccggagagagaaaggcggtccgaggagcctcccatctccctggatctcaccttccacctcctccgggaagtcttggaaatggccagggccgagcagttagcacagcaagctcacagcaacaggaaactcatggagattattgggaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - endothelin converting enzyme 2 - kallikrein-related peptidase 5 - Fas (TNFRSF6) binding factor 1 - melanoma antigen family B, 4 |