Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BATF2-basic leucine zipper transcription factor, ATF-like 2 Gene
PTXBC012330
New product
Data sheet of BATF2-basic leucine zipper transcription factor, ATF-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BATF2-basic leucine zipper transcription factor, ATF-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012330 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BATF2 |
| Origin species: | Human |
| Product name: | BATF2-basic leucine zipper transcription factor, ATF-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC012330 |
| Gene id: | 116071 |
| Gene description: | basic leucine zipper transcription factor, ATF-like 2 |
| Synonyms: | SARI; basic leucine zipper transcriptional factor ATF-like 2; B-ATF-2; basic leucine zipper transcription factor, ATF-like 2; suppressor of AP-1 regulated by IFN; basic leucine zipper ATF-like transcription factor 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattgtgcctcctgctcagctccagggctcctgggctgctgggaccaggctgaggggctcctgggccctggcccacagggacaacatggctgccgggagcagctggagctgttccagaccccgggttcctgttacccagctcagccgctctctccaggtccacagcctcatgattctcccagcctcctccagtgccccctgccctcactgtcccttggccccgctgtggttgctgaacctcctgtccagctgtcccccagccctctcctgtttgcctcgcacactggttccagcctgcaggggtcttcctctaagctcagtgccctccagcccagcctcacggcccaaactgcccctccacagcccctcgagctggagcatcccaccagagggaagctggggtcctctcccgacaacccttcctctgccctggggcttgcacgtctgcagagcagggagcacaaacctgctctctcagcagccacttggcaagggctggttgtggatcccagccctcaccctctcctggcctttcctctgctctcctctgctcaagtccacttctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 3, subunit G - guanine nucleotide binding protein (G protein), beta 5 - TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae) - YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae) |