Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFSF12-tumor necrosis factor (ligand) superfamily, member 12 Gene
PTXBC019047
New product
Data sheet of TNFSF12-tumor necrosis factor (ligand) superfamily, member 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFSF12-tumor necrosis factor (ligand) superfamily, member 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019047 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFSF12 |
| Origin species: | Human |
| Product name: | TNFSF12-tumor necrosis factor (ligand) superfamily, member 12 Gene |
| Size: | 2ug |
| Accessions: | BC019047 |
| Gene id: | 8742 |
| Gene description: | tumor necrosis factor (ligand) superfamily, member 12 |
| Synonyms: | APO3L; DR3LG; TNLG4A; tumor necrosis factor ligand superfamily member 12; APO3 ligand; APO3/DR3 ligand; TNF-related WEAK inducer of apoptosis; tumor necrosis factor (ligand) superfamily, member 12; tumor necrosis factor ligand 4A; tumor necrosis factor superfamily member 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcccgtcggagccagaggcggagggggcgccggggggagccgggcaccgccctgctggtcccgctcgcgctgggcctgggcctggcgctggcctgcctcggcctcctgctggccgtggtcagtttggggagccgggcatcgctgtccgcccaggagcctgcccaggaggagctggtggcagaggaggaccaggacccgtcggaactgaatccccagacagaagaaagccaggatcctgcgcctttcctgaaccgactagttcggcctcgcagaagtgcacctaaaggccggaaaacacgggctcgaagagcgatcgcagcccattatgaagttcatccacgacctggacaggacggagcgcaggcagatggaggttacacaacttgtctgaggccatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G-protein signaling modulator 3 (AGS3-like, C. elegans) - tumor necrosis factor (ligand) superfamily, member 10 - eukaryotic translation initiation factor 4A, isoform 2 - major facilitator superfamily domain containing 6-like |