Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GPSM3-G-protein signaling modulator 3 (AGS3-like, C. elegans) Gene
PTXBC018724
New product
Data sheet of GPSM3-G-protein signaling modulator 3 (AGS3-like, C. elegans) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPSM3-G-protein signaling modulator 3 (AGS3-like, C. elegans) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018724 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPSM3 |
| Origin species: | Human |
| Product name: | GPSM3-G-protein signaling modulator 3 (AGS3-like, C. elegans) Gene |
| Size: | 2ug |
| Accessions: | BC018724 |
| Gene id: | 63940 |
| Gene description: | G-protein signaling modulator 3 (AGS3-like, C. elegans) |
| Synonyms: | AGS4; C6orf9; G18.1a; G18.1b; G18.2; NG1; G-protein-signaling modulator 3; G-protein signaling modulator 3 (AGS3-like, C. elegans); G-protein signalling modulator 3 (AGS3-like, C. elegans); activator of G-protein signaling 4; G-protein signaling modulator 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggctgagagaccccaggaagaagaggatggtgagcagggcccccctcaggatgaggaaggctggccccctccaaactccaccactcggccttggcgatctgctcctccatcccctcctcctccagggacccgccacacagccctgggaccccgctcggcctccctgctctccctgcagactgaactccttctggacctggtggctgaagcccagtcccgccgcctggaggagcagagggccaccttctacaccccccaaaacccctcaagcctagcccctgccccactccgtcctctcgaggacagagaacagctttacagcactatcctcagtcaccagtgccagcggatggaagcccagcggtcagagcctcccctccctccaggggggcaagagctcctggagttgctgctgagagttcagggtgggggtcgaatggaggagcaaaggtcccggccccccacacacacctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor (ligand) superfamily, member 10 - eukaryotic translation initiation factor 4A, isoform 2 - major facilitator superfamily domain containing 6-like - v-ets erythroblastosis virus E26 oncogene homolog (avian) |