Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFSF10-tumor necrosis factor (ligand) superfamily, member 10 Gene
PTXBC032722
New product
Data sheet of TNFSF10-tumor necrosis factor (ligand) superfamily, member 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFSF10-tumor necrosis factor (ligand) superfamily, member 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032722 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFSF10 |
| Origin species: | Human |
| Product name: | TNFSF10-tumor necrosis factor (ligand) superfamily, member 10 Gene |
| Size: | 2ug |
| Accessions: | BC032722 |
| Gene id: | 8743 |
| Gene description: | tumor necrosis factor (ligand) superfamily, member 10 |
| Synonyms: | APO2L; Apo-2L; CD253; TL2; TNLG6A; tumor necrosis factor ligand superfamily member 10; Apo-2 ligand; TNF-related apoptosis inducing ligand TRAIL; chemokine tumor necrosis factor ligand superfamily member 10; tumor necrosis factor (ligand) family, member 10; tumor necrosis factor (ligand) superfamily, member 10; tumor necrosis factor apoptosis-inducing ligand splice variant delta; tumor necrosis factor ligand 6A; tumor necrosis factor superfamily member 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctatgatggaggtccaggggggacccagcctgggacagacctgcgtgctgatcgtgatcttcacagtgctcctgcagtctctctgtgtggctgtaacttacgtgtactttaccaacgagctgaagcagatgcaggacaagtactccaaaagtggcattgcttgtttcttaaaagaagatgacagttattgggaccccaatgacgaagagagtatgaacagcccctgctggcaagtcaagtggcaactccgtcagctcgttagaaagatgattttgagaacctctgaggaaaccatttctacagttcaagaaaagcaacaaaatatttctcccctagtgagagaaagaggtcctcagagagtagcagctcacataactgggaccagaggaagaagcaacacattgtcttctccaaactccaagaatgaaaaggctctgggccgcaaaataaactcctgggaatcatcaaggagtgggcattcattcctgagcaacttgcacttgaggaatggtgaactggtcatccatgaaaaagggttttactacatctattcccaaacatactttcgatttcaggaggaaataaaagaaaacacaaagaacgacaaacaaatggtccaatatatttacaaatacacaagttatcctgaccctatattgttgatgaaaagtgctagaaatagttgttggtctaaagatgcagaatatggactctattccatctatcaagggggaatatttgagcttaaggaaaatgacagaatttttgtttctgtaacaaatgagcacttgatagacatggaccatgaagccagttttttcggggcctttttagttggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 4A, isoform 2 - major facilitator superfamily domain containing 6-like - v-ets erythroblastosis virus E26 oncogene homolog (avian) - synaptosomal-associated protein, 91kDa homolog (mouse) |