Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of YRDC-yrdC domain containing (E. coli) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about YRDC-yrdC domain containing (E. coli) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008984 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | YRDC |
| Origin species: | Human |
| Product name: | YRDC-yrdC domain containing (E. coli) Gene |
| Size: | 2ug |
| Accessions: | BC008984 |
| Gene id: | 79693 |
| Gene description: | yrdC domain containing (E. coli) |
| Synonyms: | yrdC N6-threonylcarbamoyltransferase domain containing; yrdC domain containing; yrdC N(6)-threonylcarbamoyltransferase domain containing; yrdC domain-containing protein, mitochondrial; DRIP3; IRIP; SUA5; dopamine receptor interacting protein 3; hIRIP; ischemia/reperfusion inducible protein; ischemia/reperfusion-inducible protein homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaacgctcggaggagctcaacaaggacctaaacccttttacgcctcttgtaggcattcggattcctgatcatgcttttatgcaagacttggctcagatgtttgagggtccgcttgctctcactagtgccaacctcagctcccaggccagttctctgaatgtcgaggagttccaggatctctggcctcagttgtccttggttattgatgggggacaaattggggatggccagagccccgagtgtcgccttggctcaactgtggttgatttgtctgtgcccggaaagtttggcatcattcgtccaggctgtgccctggaaagtactacagccatcctccaacagaagtacggactgctcccctcacatgcgtcctacctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tripartite motif-containing 65 - G protein-coupled receptor 157 - cytochrome c oxidase subunit Va - RAS-like, family 11, member B |