Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TRIM65-tripartite motif-containing 65 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TRIM65-tripartite motif-containing 65 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013181 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TRIM65 |
| Origin species: | Human |
| Product name: | TRIM65-tripartite motif-containing 65 Gene |
| Size: | 2ug |
| Accessions: | BC013181 |
| Gene id: | 201292 |
| Gene description: | tripartite motif-containing 65 |
| Synonyms: | 4732463G12Rik; tripartite motif-containing protein 65; tripartite motif containing 65 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcccagagcttccaggccgggcaccactactgggaggtgcgcgcgtcagaccactcggtgacactgggcgtctcctacccgcaactgccacggtgcaggctggggccccacacagacaacattggccggggaccctgctcctgggggctctgcgtccaggaggacagcctccaggcctggcacaacggggaagcccagcgcctcccaggggtgtcagggcggctcctgggcatggatttggacctggcctcaggctgcctcaccttctacagcctggagccccagacccagcccctgtacaccttccatgccctcttcaaccagcccctcacccccgtcttctggctcctcgagggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - G protein-coupled receptor 157 - cytochrome c oxidase subunit Va - RAS-like, family 11, member B - chromatin modifying protein 4A |