Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of COX5A-cytochrome c oxidase subunit Va Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX5A-cytochrome c oxidase subunit Va Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024240 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX5A |
| Origin species: | Human |
| Product name: | COX5A-cytochrome c oxidase subunit Va Gene |
| Size: | 2ug |
| Accessions: | BC024240 |
| Gene id: | 9377 |
| Gene description: | cytochrome c oxidase subunit Va |
| Synonyms: | COX; COX-VA; cytochrome c oxidase subunit 5A, mitochondrial; cytochrome c oxidase polypeptide Va; cytochrome c oxidase polypeptide, mitochondrial; cytochrome c oxidase subunit Va; mitochondrial cytochrome c oxidase subunit Va; cytochrome c oxidase subunit 5A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgggcgccgctctccgccgctgcgctgtggccgcaaccacccgggccgaccctcgaggcctcctgcactccgcccggacccccggccccgccgtggctatccagtcagttcgctgctattcccatgggtcacaggagacagatgaggagtttgatgctcgctgggtaacatacttcaacaagccagatatagatgcctgggaattgcgtaaagggataaacacacttgttacctatgatatggttccagagcccaaaatcattgatgctgctttgcgggcatgcagacggttaaatgattttgctagtacagttcgtatcctagaggttgttaaggacaaagcaggacctcataaggaaatctacccctatgtcatccaggaacttagaccaactttaaatgaactgggaatctccactccggaggaactgggccttgacaaagtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAS-like, family 11, member B - chromatin modifying protein 4A - nicotinamide N-methyltransferase - transmembrane protein 59-like |