Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FXC1-fracture callus 1 homolog (rat) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FXC1-fracture callus 1 homolog (rat) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011014 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FXC1 |
| Origin species: | Human |
| Product name: | FXC1-fracture callus 1 homolog (rat) Gene |
| Size: | 2ug |
| Accessions: | BC011014 |
| Gene id: | 26515 |
| Gene description: | fracture callus 1 homolog (rat) |
| Synonyms: | FXC1; TIM10B; Tim9b; mitochondrial import inner membrane translocase subunit Tim10 B; fracture callus 1 homolog; fracture callus protein 1; mitochondrial import inner membrane translocase subunit Tim9 B; translocase of inner mitochondrial membrane 10 homolog B; translocase of inner mitochondrial membrane 10B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcggcagcagcagcagcaacagcaactgcgaaacctgcgtgacttcctgttggtctacaatcggatgacagaactctgcttccagcgctgtgtgcccagcttgcaccaccgagctctggacgctgaggaggaggcctgtctgcacagctgtgctgggaagctgatccattccaaccaccgcctcatggccgcttacgtgcagctcatgcctgccctggtacagcgccgcatcgcagactacgaggctgcctcggctgtgccaagcgttgctgctgaacagcctggggtctctccatcaggcagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - natriuretic peptide precursor B - FK506 binding protein 3, 25kDa - sorting nexin family member 21 - PDZ and LIM domain 7 (enigma) |