Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FKBP3-FK506 binding protein 3, 25kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FKBP3-FK506 binding protein 3, 25kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016288 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FKBP3 |
| Origin species: | Human |
| Product name: | FKBP3-FK506 binding protein 3, 25kDa Gene |
| Size: | 2ug |
| Accessions: | BC016288 |
| Gene id: | 2287 |
| Gene description: | FK506 binding protein 3, 25kDa |
| Synonyms: | PPIase FKBP3; peptidyl-prolyl cis-trans isomerase FKBP3; FKBP-25; FKBP-3; FKBP25; PPIase; 25 kDa FK506-binding protein; 25 kDa FKBP; FK506 binding protein 3, 25kDa; FK506-binding protein 25, T-cell; immunophilin FKBP25; rapamycin binding protein; rapamycin-selective 25 kDa immunophilin; rotamase; FK506 binding protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcggccgttccacagcgggcgtggaccgtggagcagctgcgcagtgagcagctgcccaagaaggacattatcaagtttctgcaggaacacggttcagattcgtttcttgcagaacataaattattaggaaacattaaaaatgtggccaagacagctaacaaggaccacttggttacagcctataaccatctttttgaaactaagcgttttaagggtactgaaagtataagtaaagtgtctgagcaagtaaaaaatgtgaagcttaatgaagataaacccaaagaaaccaagtctgaagagaccctggatgagggtccaccaaaatatactaaatctgttctgaaaaagggagataaaaccaactttcccaaaaagggagatgttgttcactgctggtatacaggaacactacaagatgggactgtttttgatactaatattcaaacaagtgcaaagaagaagaaaaatgccaagcctttaagttttaaggtcggagtaggcaaagttatcagaggatgggatgaagctctcttgactatgagtaaaggagaaaaggctcgactggagattgaaccagaatgggcttacggaaagaaaggacagcctgatgccaaaattccaccaaatgcaaaactcacttttgaagtggaattagtggatattgattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sorting nexin family member 21 - PDZ and LIM domain 7 (enigma) - hexokinase domain containing 1 - numb homolog (Drosophila)-like |