Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PDLIM7-PDZ and LIM domain 7 (enigma) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PDLIM7-PDZ and LIM domain 7 (enigma) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014521 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PDLIM7 |
| Origin species: | Human |
| Product name: | PDLIM7-PDZ and LIM domain 7 (enigma) Gene |
| Size: | 2ug |
| Accessions: | BC014521 |
| Gene id: | 9260 |
| Gene description: | PDZ and LIM domain 7 (enigma) |
| Synonyms: | LMP1; LMP3; PDZ and LIM domain protein 7; 1110003B01Rik; LIM domain protein; LMP; Lim mineralization protein 3; PDZ and LIM domain 7 (enigma); protein enigma; PDZ and LIM domain 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggattccttcaaagtagtgctggaggggccagcaccttggggcttccggctgcaagggggcaaggacttcaatgtgcccctctccatttcccggctcactcctgggggcaaagcggcgcaggccggagtggccgtgggtgactgggtgctgagcatcgatggcgagaatgcgggtagcctcacacacatcgaagctcagaacaagatccgggcctgcggggagcgcctcagcctgggcctcagcagggcccagccggttcagagcaaaccgcagaaggcctccgcccccgccgcggaccctccgcggtacacctttgcacccagcgtctccctcaacaagacggcccggccctttggggcgcccccgcccgctgacagcgccccgcagcagaatggacagccgctccgaccgctggtcccagatgccagcaagcagcggctgatggagaacacagaggactggcggccgcggccggggacaggccagtcgcgttccttccgcatccttgcccacctcacaggcaccgagttcatgcaagacccggatgaggagcacctgaagaaatcaagggaaaagtatgtcctggagctgcagagcccacgctacacccgcctccgggactggcaccaccagcgctctgcccacgtgctcaacgtgcagtcgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hexokinase domain containing 1 - numb homolog (Drosophila)-like - polo-like kinase 3 (Drosophila) - polo-like kinase 1 (Drosophila) |