NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene View larger

NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene

PTXBC011910

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011910
Product type: DNA & cDNA
Ncbi symbol: NDUFA4L2
Origin species: Human
Product name: NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene
Size: 2ug
Accessions: BC011910
Gene id: 56901
Gene description: NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2
Synonyms: NUOMS; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4-like 2; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2; NADH:ubiquinone oxidoreductase MLRQ subunit homolog; NDUFA4, mitochondrial complex associated like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggagccagtcttggggcccgcttctaccggcagatcaaaagacatccggggatcatcccgatgatcggcttaatctgcctgggcatgggcagcgctgcgctttacttgctgcgactcgcccttcgcagccccgacgtctgctgggacagaaagaacaacccggagccctggaaccgcctgagccccaatgaccaatacaagttccttgcagtttccactgactataagaagctgaagaaggaccggccagacttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - translocase of outer mitochondrial membrane 20 homolog (yeast)
- v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)
- mitochondrial translation optimization 1 homolog (S. cerevisiae)
- G protein-coupled receptor 37 (endothelin receptor type B-like)

Buy NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene now

Add to cart