Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene
PTXBC011910
New product
Data sheet of NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011910 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NDUFA4L2 |
| Origin species: | Human |
| Product name: | NDUFA4L2-NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 Gene |
| Size: | 2ug |
| Accessions: | BC011910 |
| Gene id: | 56901 |
| Gene description: | NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2 |
| Synonyms: | NUOMS; NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 4-like 2; NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4-like 2; NADH:ubiquinone oxidoreductase MLRQ subunit homolog; NDUFA4, mitochondrial complex associated like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggagccagtcttggggcccgcttctaccggcagatcaaaagacatccggggatcatcccgatgatcggcttaatctgcctgggcatgggcagcgctgcgctttacttgctgcgactcgcccttcgcagccccgacgtctgctgggacagaaagaacaacccggagccctggaaccgcctgagccccaatgaccaatacaagttccttgcagtttccactgactataagaagctgaagaaggaccggccagacttctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - translocase of outer mitochondrial membrane 20 homolog (yeast) - v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) - mitochondrial translation optimization 1 homolog (S. cerevisiae) - G protein-coupled receptor 37 (endothelin receptor type B-like) |