GPR37-G protein-coupled receptor 37 (endothelin receptor type B-like) Gene View larger

GPR37-G protein-coupled receptor 37 (endothelin receptor type B-like) Gene

PTXBC040007

New product

Data sheet of GPR37-G protein-coupled receptor 37 (endothelin receptor type B-like) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPR37-G protein-coupled receptor 37 (endothelin receptor type B-like) Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC040007
Product type: DNA & cDNA
Ncbi symbol: GPR37
Origin species: Human
Product name: GPR37-G protein-coupled receptor 37 (endothelin receptor type B-like) Gene
Size: 2ug
Accessions: BC040007
Gene id: 2861
Gene description: G protein-coupled receptor 37 (endothelin receptor type B-like)
Synonyms: prosaposin receptor GPR37; EDNRBL; PAELR; hET(B)R-LP; ETBR-LP-1; G protein-coupled receptor 37 (endothelin receptor type B-like); Parkin-associated endothelin receptor-like receptor; endothelin B receptor-like protein 1; G protein-coupled receptor 37
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgagccccgggcgcgcttctcgcccgcatgtcgcggctactgcttctgctactgctcaaggtgtctgcctcttctgccctcggggtcgcccctgcgtccagaaacgaaacttgtctgggggagagctgtgcacctacagtgatccagcgccgcggcagggacgcctggggaccgggaaattctgcaagagacgttctgcgagcccgagcacccagggaggagcagggggcagcgtttcttgcgggaccctcctgggacctgccggcggccccgggccgtgacccggctgcaggcagaggggcggaggcgtcggcagccggacccccgggacctccaaccaggccacctggcccctggaggtggaaaggtgctcggggtcaggagccttctgaaactttggggagagggaaccccacggccctccagctcttccttcagatctcagaggaggaagagaagggtcccagaggcgctggcatttccgggcgtagccaggagcagagtgtgaagacagtccccggagccagcgatcttttttactggccaaggagagccgggaaactccagggttcccaccacaagcccctgtccaagacggccaatggactggcggggcacgaagggtggacaattgcactcccgggccgggcgctggcccagaatggatccttgggtgaaggaatccatgagcctgggggtccccgccggggaaacagcacgaaccggcgtgtgagactgaagaaccccttctacccgctgacccaggagtcctatggagcctacgcggtcatgtgtctgtccgtggtgatcttcgggaccggcatcattggcaacctggcggtgatgtgcatcgtgtgccacaactactacatgcggagcatctccaactccctcttggccaacctggccttctgggactttctcatcatcttcttctgccttccgctggtcatcttccacgagctgaccaagaagtggctgctggaggacttctcctgcaagatcgtgccctatatagaggtcgcttctctgggagtcaccaccttcaccttatgtgctctgtgcatagaccgcttccgtgctgccaccaacgtacagatgtactacgaaatgatcgaaaactgttcctcaacaactgccaaacttgctgttatatgggtgggagctctattgttagcacttccagaagttgttctccgccagctgagcaaggaggatttggggtttagtggccgagctccggcagaaaggtgcattattaagatctctcctgatttaccagacaccatctatgttctagccctcacctacgacagtgcgagactgtggtggtattttggctgttacttttgtttgcccacgcttttcaccatcacctgctctctagtgactgcgaggaaaatccgcaaagcagagaaagcctgtacccgagggaataaacggcagattcaactagagagtcagatgaactgtacagtagtggcactgaccattttatatggattttgcattattcctgaaaatatctgcaacattgttactgcctacatggctacaggggtttcacagcagacaatggacctccttaatatcatcagccagttccttttgttctttaagtcctgtgtcaccccagtcctccttttctgtctctgcaaacccttcagtcgggccttcatggagtgctgctgctgttgctgtgaggaatgcattcagaagtcttcaacggtgaccagtgatgacaatgacaacgagtacaccacggaactcgaactctcgcctttcagtaccatacgccgtgaaatgtccacttttgcttctgtcggaactcattgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
- translocase of inner mitochondrial membrane 23 homolog (yeast)
- amine oxidase, copper containing 3 (vascular adhesion protein 1)
- general transcription factor IIH, polypeptide 2, 44kDa-like

Buy GPR37-G protein-coupled receptor 37 (endothelin receptor type B-like) Gene now

Add to cart