No products
Prices are tax excluded
PTXBC000882
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000882 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TOMM20 |
| Origin species: | Human |
| Product name: | TOMM20-translocase of outer mitochondrial membrane 20 homolog (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC000882 |
| Gene id: | 9804 |
| Gene description: | translocase of outer mitochondrial membrane 20 homolog (yeast) |
| Synonyms: | MAS20; MOM19; mitochondrial import receptor subunit TOM20 homolog; mitochondrial 20 kDa outer membrane protein; outer mitochondrial membrane receptor Tom20; translocase of outer mitochondrial membrane 20 homolog type II; translocase of outer mitochondrial membrane 20 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgggtcggaacagcgccatcgccgccggtgtatgcggggcccttttcattgggtactgcatctacttcgaccgcaaaagacgaagtgaccccaacttcaagaacaggcttcgagaacgaagaaagaaacagaagcttgccaaggagagagctgggctttccaagttacctgaccttaaagatgctgaagctgttcagaagttcttccttgaagaaatacagcttggtgaagagttactagctcaaggtgaatatgagaagggcgtagaccatctgacaaatgcaattgctgtgtgtggacagccacagcagttactgcaggtcttacagcaaactcttccaccaccagtgttccagatgcttctgactaagctcccaacaattagtcagagaattgtaagtgctcagagcttggctgaagatgatgtggaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian) - mitochondrial translation optimization 1 homolog (S. cerevisiae) - G protein-coupled receptor 37 (endothelin receptor type B-like) - transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) |