SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene View larger

SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene

PTXBC040237

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040237
Product type: DNA & cDNA
Ncbi symbol: SNHG11
Origin species: Human
Product name: SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene
Size: 2ug
Accessions: BC040237
Gene id: 128439
Gene description: small nucleolar RNA host gene 11 (non-protein coding)
Synonyms: A930034L06Rik; AI854265; AL022637; AW319638; E130013N09Rik; small nucleolar RNA host gene 11 (non-protein coding); small nucleolar RNA host gene 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggggcagggcccgaggagtggtcttcccaagaacccctggtggcctcccaaggccggtgctgtgtacctcctccacgacaaaaggggaaactgaggccccgaggggagtgggaagagccggctggacgtcaggcccagccgctggtgcagtggtccgtcccctctgccggggtgggcccctcgggtttcgcgtgtcctcgggaaagagactggcgggtgagccgcgccctcggccttcgctgggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
- potassium voltage-gated channel, subfamily G, member 1
- cytochrome P450, family 2, subfamily J, polypeptide 2
- immunoglobulin heavy variable 7-81 (non-functional)

Buy SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene now

Add to cart