Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene
PTXBC040237
New product
Data sheet of SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC040237 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNHG11 |
| Origin species: | Human |
| Product name: | SNHG11-small nucleolar RNA host gene 11 (non-protein coding) Gene |
| Size: | 2ug |
| Accessions: | BC040237 |
| Gene id: | 128439 |
| Gene description: | small nucleolar RNA host gene 11 (non-protein coding) |
| Synonyms: | A930034L06Rik; AI854265; AL022637; AW319638; E130013N09Rik; small nucleolar RNA host gene 11 (non-protein coding); small nucleolar RNA host gene 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggggcagggcccgaggagtggtcttcccaagaacccctggtggcctcccaaggccggtgctgtgtacctcctccacgacaaaaggggaaactgaggccccgaggggagtgggaagagccggctggacgtcaggcccagccgctggtgcagtggtccgtcccctctgccggggtgggcccctcgggtttcgcgtgtcctcgggaaagagactggcgggtgagccgcgccctcggccttcgctgggctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) - potassium voltage-gated channel, subfamily G, member 1 - cytochrome P450, family 2, subfamily J, polypeptide 2 - immunoglobulin heavy variable 7-81 (non-functional) |