GNG7-guanine nucleotide binding protein (G protein), gamma 7 Gene View larger

GNG7-guanine nucleotide binding protein (G protein), gamma 7 Gene

PTXBC014466

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNG7-guanine nucleotide binding protein (G protein), gamma 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNG7-guanine nucleotide binding protein (G protein), gamma 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014466
Product type: DNA & cDNA
Ncbi symbol: GNG7
Origin species: Human
Product name: GNG7-guanine nucleotide binding protein (G protein), gamma 7 Gene
Size: 2ug
Accessions: BC014466
Gene id: 2788
Gene description: guanine nucleotide binding protein (G protein), gamma 7
Synonyms: guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-7; guanine nucleotide binding protein (G protein), gamma 7; G protein subunit gamma 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagccactaacaacatagcccaggcccggaagctggtggaacagctacgcatagaagccgggattgagcgcatcaaggtctccaaagcggcgtctgacctcatgagctactgtgagcaacatgcccggaacgaccccctgctggtcggagtccctgcctcggagaacccctttaaggacaagaaaccttgtattattttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - small nucleolar RNA host gene 11 (non-protein coding)
- SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
- potassium voltage-gated channel, subfamily G, member 1
- cytochrome P450, family 2, subfamily J, polypeptide 2

Buy GNG7-guanine nucleotide binding protein (G protein), gamma 7 Gene now

Add to cart