TFF1-trefoil factor 1 Gene View larger

TFF1-trefoil factor 1 Gene

PTXBC032811

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TFF1-trefoil factor 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TFF1-trefoil factor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032811
Product type: DNA & cDNA
Ncbi symbol: TFF1
Origin species: Human
Product name: TFF1-trefoil factor 1 Gene
Size: 2ug
Accessions: BC032811
Gene id: 7031
Gene description: trefoil factor 1
Synonyms: BCEI; D21S21; HP1.A; HPS2; pNR-2; pS2; trefoil factor 1; breast cancer estrogen-inducible protein; breast cancer estrogen-inducible sequence; gastrointestinal trefoil protein pS2; polypeptide P1.A; protein pS2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaccatggagaacaaggtgatctgcgccctggtcctggtgtccatgctggccctcggcaccctggccgaggcccagacagagacgtgtacagtggccccccgtgaaagacagaattgtggttttcctggtgtcacgccctcccagtgtgcaaataagggctgctgtttcgacgacaccgttcgtggggtcccctggtgcttctatcctaataccatcgacgtccctccagaagaggagtgtgaattttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - forkhead box N3
- metallothionein 3
- proline rich 15
- trefoil factor 2

Buy TFF1-trefoil factor 1 Gene now

Add to cart