FOXN3-forkhead box N3 Gene View larger

FOXN3-forkhead box N3 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FOXN3-forkhead box N3 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FOXN3-forkhead box N3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010460
Product type: DNA & cDNA
Ncbi symbol: FOXN3
Origin species: Human
Product name: FOXN3-forkhead box N3 Gene
Size: 2ug
Accessions: BC010460
Gene id: 1112
Gene description: forkhead box N3
Synonyms: C14orf116; CHES1; PRO1635; forkhead box protein N3; checkpoint suppressor 1; forkhead box N3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaggatttacacatggcattcagtgttctgtatagatctgcctacctttgtgaattcatctgttaacccctcttcctttgagagagcaccggcgatggtggttaactccttgtgttttctctctctcctactggttattcttgaattaagcacagactcgtcagctcggttgctttatcatgaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - metallothionein 3
- proline rich 15
- trefoil factor 2
- prepronociceptin

Buy FOXN3-forkhead box N3 Gene now

Add to cart