MT3-metallothionein 3 Gene View larger

MT3-metallothionein 3 Gene

PTXBC013081

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MT3-metallothionein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MT3-metallothionein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013081
Product type: DNA & cDNA
Ncbi symbol: MT3
Origin species: Human
Product name: MT3-metallothionein 3 Gene
Size: 2ug
Accessions: BC013081
Gene id: 4504
Gene description: metallothionein 3
Synonyms: GIF; GIFB; GRIF; ZnMT3; metallothionein-3; MT-3; MT-III; growth inhibitory factor; metallothionein 3 (growth inhibitory factor (neurotrophic)); metallothionein-III; metallothionein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccctgagacctgcccctgcccttctggtggctcctgcacctgcgcggactcctgcaagtgcgagggatgcaaatgcacctcctgcaagaagagctgctgctcctgctgccctgcggagtgtgagaagtgtgccaaggactgtgtgtgcaaaggcggagaggcagctgaggcagaagcagagaagtgcagctgctgccagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proline rich 15
- trefoil factor 2
- prepronociceptin
- cytokine-like 1

Buy MT3-metallothionein 3 Gene now

Add to cart