FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene View larger

FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002614
Product type: DNA & cDNA
Ncbi symbol: FKBP1B
Origin species: Human
Product name: FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene
Size: 2ug
Accessions: BC002614
Gene id: 2281
Gene description: FK506 binding protein 1B, 12.6 kDa
Synonyms: PPIase FKBP1B; peptidyl-prolyl cis-trans isomerase FKBP1B; FKBP12.6; FKBP1L; OTK4; PKBP1L; PPIase; 12.6 kDa FK506-binding protein; 12.6 kDa FKBP; FK506 binding protein 1B, 12.6 kDa; FK506-binding protein 12.6; FKBP-12.6; FKBP-1B; calstabin 2; h-FKBP-12; immunophilin FKBP12.6; rotamase; FK506 binding protein 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcgtggagatcgagaccatctcccccggagacggaaggacattccccaagaagggccaaacgtgtgtggtgcactacacaggaatgctccaaaatgggaagaagtttgattcatccagagacagaaacaaacctttcaagttcagaattggcaaacaggaagtcatcaaaggttttgaagagggtgcagcccagctgggtcctctttctcctctccccatctgcccccatccctgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rho GTPase activating protein 17
- fatty acid binding protein 7, brain
- fatty acid binding protein 6, ileal
- endothelial cell-specific molecule 1

Buy FKBP1B-FK506 binding protein 1B, 12.6 kDa Gene now

Add to cart