ARHGAP17-Rho GTPase activating protein 17 Gene View larger

ARHGAP17-Rho GTPase activating protein 17 Gene

PTXBC001241

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ARHGAP17-Rho GTPase activating protein 17 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ARHGAP17-Rho GTPase activating protein 17 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001241
Product type: DNA & cDNA
Ncbi symbol: ARHGAP17
Origin species: Human
Product name: ARHGAP17-Rho GTPase activating protein 17 Gene
Size: 2ug
Accessions: BC001241
Gene id: 55114
Gene description: Rho GTPase activating protein 17
Synonyms: MST066; MST110; MSTP038; MSTP066; MSTP110; NADRIN; PP367; PP4534; RICH-1; RICH1; WBP15; rho GTPase-activating protein 17; RhoGAP interacting with CIP4 homologs 1; neuron-associated developmentally regulated protein; rho-type GTPase-activating protein 17; Rho GTPase activating protein 17
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcacaccaaacccaatagccagggccctcccaaccccatggcattgcccagtgagcatggacttgagcagccatctcacacccctccccagactccaacgccccccagtactccgcccctaggaaaacagaaccccagtctgccagctcctcagaccctggcagggggtaaccctgaaactgcacagccacatgctggaaccttaccgagaccgagaccagtaccaaagccaaggaaccggcccagcgtgcccccacccccccaacctcctggtgtccactcagctggggacagcagcctcaccaacacagcaccaacagcttccaagatagtaacagatgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fatty acid binding protein 7, brain
- fatty acid binding protein 6, ileal
- endothelial cell-specific molecule 1
- gap junction protein, alpha 4, 37kDa

Buy ARHGAP17-Rho GTPase activating protein 17 Gene now

Add to cart