Cart 29 Product Products 4 010,43 € (empty)
-
1 x HIST1H2AJ-...113,40 € -
1 x CYTH2-cyto...121,50 € -
1 x ITGB3BP-in...113,40 € -
1 x ADH4-alcoh...121,50 € -
1 x GLIPR1-GLI...121,50 € -
1 x NUSAP1-nuc...121,50 € -
-
1 x SLC2A3-sol...121,50 € -
1 x PBX2-pre-B...121,50 € -
1 x FMO2-flavi...121,50 € -
1 x TMEM9B-TME...113,40 € -
-
1 x SPIN2B-spi...113,40 € -
1 x ZNRD1-zinc...113,40 € -
1 x PCGF2-poly...121,50 € -
1 x CRB3-crumb...113,40 € -
-
1 x GGCT-gamma...113,40 € -
1 x NUDCD3-Nud...121,50 € -
1 x SPG7-spast...121,50 € -
-
-
1 x NUP43-nucl...121,50 € -
1 x ZNF688-zin...121,50 € -
-
1 x WWP2-WW...121,50 € -
-
1 x ZNF738-zin...113,40 € -
No products
To be determined Shipping
4 010,43 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 29 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 010,43 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 010,43 €
Data sheet of FABP6-fatty acid binding protein 6, ileal Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FABP6-fatty acid binding protein 6, ileal Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022489 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FABP6 |
| Origin species: | Human |
| Product name: | FABP6-fatty acid binding protein 6, ileal Gene |
| Size: | 2ug |
| Accessions: | BC022489 |
| Gene id: | 2172 |
| Gene description: | fatty acid binding protein 6, ileal |
| Synonyms: | I-15P; I-BABP; I-BALB; I-BAP; ILBP; ILBP3; ILLBP; gastrotropin; fatty acid binding protein 6, ileal; ileal bile acid binding protein; ileal lipid-binding protein; illeal lipid-binding protein; intestinal 15 kDa protein; fatty acid binding protein 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctttcaccggcaagttcgagatggagagtgagaagaattatgatgagttcatgaagctccttgggatctccagcgatgtaatcgaaaaggcccacaacttcaagatcgtcacggaggtgcagcaggatgggcaggacttcacttggtcccagcactactacgggggccacaccatgaccaacaagttcactgttggcaaggaaagcaacatacagacaatggggggcaagacgttcaaggccactgtgcagatggagggcgggaagctggtggtgaatttccccaactatcaccagacctcagagatcgtgggtgacaagctggtggaggtctccaccatcggaggcgtgacctatgagcgcgtgagcaagagactggcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - endothelial cell-specific molecule 1 - gap junction protein, alpha 4, 37kDa - Fas apoptotic inhibitory molecule 2 - coiled-coil domain containing 106 |