PTXBC010933
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010933 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX17 |
| Origin species: | Human |
| Product name: | COX17-COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC010933 |
| Gene id: | 10063 |
| Gene description: | COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) |
| Synonyms: | COX17, cytochrome c oxidase copper chaperone; COX17 cytochrome c oxidase assembly homolog; cytochrome c oxidase copper chaperone; cytochrome c oxidase 17 copper chaperone; cytochrome c oxidase assembly homolog 17; human homolog of yeast mitochondrial copper recruitment |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgggtctggttgactcaaaccctgccccgcctgagtctcaggagaagaagccgctgaagccctgctgcgcttgcccggagaccaagaaggcgcgcgatgcgtgtatcatcgagaaaggagaagaacactgtggacatctaattgaggcccacaaggaatgcatgagagccctaggatttaaaatatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - sulfotransferase family 1E, estrogen-preferring, member 1 - small nuclear RNA activating complex, polypeptide 2, 45kDa - oligonucleotide/oligosaccharide-binding fold containing 2B - CASP2 and RIPK1 domain containing adaptor with death domain |