COX17-COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene View larger

COX17-COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX17-COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about COX17-COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010933
Product type: DNA & cDNA
Ncbi symbol: COX17
Origin species: Human
Product name: COX17-COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC010933
Gene id: 10063
Gene description: COX17 cytochrome c oxidase assembly homolog (S. cerevisiae)
Synonyms: COX17, cytochrome c oxidase copper chaperone; COX17 cytochrome c oxidase assembly homolog; cytochrome c oxidase copper chaperone; cytochrome c oxidase 17 copper chaperone; cytochrome c oxidase assembly homolog 17; human homolog of yeast mitochondrial copper recruitment
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgggtctggttgactcaaaccctgccccgcctgagtctcaggagaagaagccgctgaagccctgctgcgcttgcccggagaccaagaaggcgcgcgatgcgtgtatcatcgagaaaggagaagaacactgtggacatctaattgaggcccacaaggaatgcatgagagccctaggatttaaaatatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sulfotransferase family 1E, estrogen-preferring, member 1
- small nuclear RNA activating complex, polypeptide 2, 45kDa
- oligonucleotide/oligosaccharide-binding fold containing 2B
- CASP2 and RIPK1 domain containing adaptor with death domain

Buy COX17-COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) Gene now

Add to cart