Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene
PTXBC015317
New product
Data sheet of ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015317 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ST13 |
| Origin species: | Human |
| Product name: | ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene |
| Size: | 2ug |
| Accessions: | BC015317 |
| Gene id: | 6767 |
| Gene description: | suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) |
| Synonyms: | AAG2; FAM10A1; FAM10A4; HIP; HOP; HSPABP; HSPABP1; P48; PRO0786; SNC6; hsc70-interacting protein; Hsp70-interacting protein; aging-associated protein 2; heat shock 70kD protein binding protein; progesterone receptor-associated p48 protein; renal carcinoma antigen NY-REN-33; suppression of tumorigenicity 13 protein; testis secretory sperm-binding protein Li 233m; suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctttttaaatcctttaaaaacactcaccatataaacttgcatttgagcttgtgtgttcttttgttaatgtgtagagttctcctttctcgaaattgccagtgtgtacttggcttaactcaagaacagtttcttctggattccttatttgatttatttaacctaattatattctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 - solute carrier family 12 (sodium/potassium/chloride transporters), member 1 - solute carrier family 22 (organic cation/carnitine transporter), member 16 - solute carrier family 2 (facilitated glucose/fructose transporter), member 5 |