ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene View larger

ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene

PTXBC015317

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015317
Product type: DNA & cDNA
Ncbi symbol: ST13
Origin species: Human
Product name: ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene
Size: 2ug
Accessions: BC015317
Gene id: 6767
Gene description: suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
Synonyms: AAG2; FAM10A1; FAM10A4; HIP; HOP; HSPABP; HSPABP1; P48; PRO0786; SNC6; hsc70-interacting protein; Hsp70-interacting protein; aging-associated protein 2; heat shock 70kD protein binding protein; progesterone receptor-associated p48 protein; renal carcinoma antigen NY-REN-33; suppression of tumorigenicity 13 protein; testis secretory sperm-binding protein Li 233m; suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctttttaaatcctttaaaaacactcaccatataaacttgcatttgagcttgtgtgttcttttgttaatgtgtagagttctcctttctcgaaattgccagtgtgtacttggcttaactcaagaacagtttcttctggattccttatttgatttatttaacctaattatattctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
- solute carrier family 12 (sodium/potassium/chloride transporters), member 1
- solute carrier family 22 (organic cation/carnitine transporter), member 16
- solute carrier family 2 (facilitated glucose/fructose transporter), member 5

Buy ST13-suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) Gene now

Add to cart