Cart 4 Product Products 440,71 € (empty)
-
1 x CRK-v-crk...113,40 € -
1 x CDC42-cell...113,40 € -
1 x CSDC2-cold...113,40 € -
No products
To be determined Shipping
440,71 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 440,71 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 440,71 €
View larger 
SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene
PTXBC035878
New product
Data sheet of SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035878 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC2A5 |
| Origin species: | Human |
| Product name: | SLC2A5-solute carrier family 2 (facilitated glucose/fructose transporter), member 5 Gene |
| Size: | 2ug |
| Accessions: | BC035878 |
| Gene id: | 6518 |
| Gene description: | solute carrier family 2 (facilitated glucose/fructose transporter), member 5 |
| Synonyms: | GLUT-5; solute carrier family 2, facilitated glucose transporter member 5; glucose transporter type 5, small intestine; glucose transporter-like protein 5; solute carrier family 2 (facilitated glucose/fructose transporter), member 5; testicular tissue protein Li 81; solute carrier family 2 member 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcaacaggatcagagcatgaaggaagggaggctgacgcttgtgcttgccctggcaaccctgatagctgcctttgggtcatccttccagtatgggtacaacgtggctgctgtcaactccccagcactgctcatgcaacaattttacaatgagacttactatggtaggaccggtgaattcatggaagacttccccttgacgttgctgtggtctgtaaccgtgtccatgtttccatttggagggtttatcggatccctcctggtcggccccttggtgaataaatttggcagaaaaggggccttgctgttcaacaacatattttctatcgtgcctgcgatcttaatgggatgcagcagagtcgccacatcatttgagcttatcattatttccagacttttggtgggaatatgtgcaggtgtatcttccaacgtggtccccatgtacttaggggagctggcccctaaaaacctgcggggggctctcggggtggtgccccagctcttcatcactgttggcatccttgtggcccagatctttggtcttcggaatctccttgcaaacgtagatggtgagttcaggacatctcgggagcacccccaccccttcaccactacccttggccccctccttgtgttccaaagccaccaccacaggacaggactttctgcagactggtctcttctaacaggctggatgtccttggggggcccatcctgtcccgagccaacatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 - ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon - suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) |