ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene View larger

ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016812
Product type: DNA & cDNA
Ncbi symbol: ATP5C1
Origin species: Human
Product name: ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene
Size: 2ug
Accessions: BC016812
Gene id: 509
Gene description: ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Synonyms: ATP5C; ATP5CL1; ATP synthase subunit gamma, mitochondrial; ATP synthase gamma chain, mitochondrial; F-ATPase gamma subunit; mitochondrial ATP synthase, gamma subunit 1; ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttctctcgcgcgggtgtcgctgggctgtcggcctggaccttgcagccgcaatggattcaagttcgaaatatggcaactttgaaagatatcaccaggagactaaagtccatcaaaaacatccagaaaattgccaagtctatgaaaatggtagcggcagcaaaatatgcccgagctgagagagagctgaaaccagctcgaatatatggattgggatctttagctctgtatgaaaaagctgatatcaaggggcctgaagacaagaagaaacacctccttattggtgtgtcctcagatcgaggactgtgtggtgctattcattcctccattgctaaacagatgaaaagcgaggttgctacactaacagcagctgggaaagaagttatgcttgttggaattggtgacaaaatcagaggcatactttataggactcattctgaccagtttctggtggcattcaaagaagtgggaagaaagccccccacttttggagatgcgtcagtcattgcccttgaattactaaattctggatatgaatttgatgaaggctccatcatctttaataaattcaggtctgtcatctcctataagacagaagaaaagcccatcttttcccttaataccgttgcaagtgctgacagcatgagtatctatgacgatattgatgctgacgtgctgcaaaattaccaagaatacaatctggccaacatcatctactactctctgaaggagtccaccactagtgagcagagtgccaggatgacagccatggacaatgccagcaagaatgcttctgagatgattgacaaattgacattgacattcaaccgtacccgccaagctgtcatcacaaaagagttgattgaaattatctctggtgctgcagctctggattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase epsilon
- suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)
- protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
- NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12

Buy ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene now

Add to cart