Login to display prices
Login to display prices
ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene View larger

ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene

PTXBC016812

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene

Proteogenix catalog: PTXBC016812
Ncbi symbol: ATP5C1
Product name: ATP5C1-ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 Gene
Size: 2ug
Accessions: BC016812
Gene id: 509
Gene description: ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Synonyms: ATP5C; ATP5CL1; ATP synthase subunit gamma, mitochondrial; ATP synthase gamma chain, mitochondrial; F-ATPase gamma subunit; mitochondrial ATP synthase, gamma subunit 1; ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttctctcgcgcgggtgtcgctgggctgtcggcctggaccttgcagccgcaatggattcaagttcgaaatatggcaactttgaaagatatcaccaggagactaaagtccatcaaaaacatccagaaaattgccaagtctatgaaaatggtagcggcagcaaaatatgcccgagctgagagagagctgaaaccagctcgaatatatggattgggatctttagctctgtatgaaaaagctgatatcaaggggcctgaagacaagaagaaacacctccttattggtgtgtcctcagatcgaggactgtgtggtgctattcattcctccattgctaaacagatgaaaagcgaggttgctacactaacagcagctgggaaagaagttatgcttgttggaattggtgacaaaatcagaggcatactttataggactcattctgaccagtttctggtggcattcaaagaagtgggaagaaagccccccacttttggagatgcgtcagtcattgcccttgaattactaaattctggatatgaatttgatgaaggctccatcatctttaataaattcaggtctgtcatctcctataagacagaagaaaagcccatcttttcccttaataccgttgcaagtgctgacagcatgagtatctatgacgatattgatgctgacgtgctgcaaaattaccaagaatacaatctggccaacatcatctactactctctgaaggagtccaccactagtgagcagagtgccaggatgacagccatggacaatgccagcaagaatgcttctgagatgattgacaaattgacattgacattcaaccgtacccgccaagctgtcatcacaaaagagttgattgaaattatctctggtgctgcagctctggattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: