PCMTD2-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 Gene View larger

PCMTD2-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCMTD2-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PCMTD2-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033665
Product type: DNA & cDNA
Ncbi symbol: PCMTD2
Origin species: Human
Product name: PCMTD2-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 Gene
Size: 2ug
Accessions: BC033665
Gene id: 55251
Gene description: protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Synonyms: C20orf36; protein-L-isoaspartate O-methyltransferase domain-containing protein 2; protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcggtgctgtgagtgctggtgaagacaatgatgagctgatagataatttgaaagaagcacagtatatccggactgagctggtagagcaggctttcagagctatcgatcgtgcagactattatcttgaagaatttaaagaaaatgcttataaagacttggcatggaagcatggaaacattcacctctcagccccgtgcatctactcggaggtgatggaagccctagatctgcagcctggactctcgtttctgaacctgggcagtggcactgggtatctcagctccatggtgggcctcattctaggtccttttggtgtgaaccatggggtggaacttcactcagatgtgatagagtatgcaaagcagaaactggacttcttcatcagaacaagtgatagttttgacaagtttgacttctgtgaaccttcctttgttactgggaattgcctggagatttctccggattgttctcagtatgatcgtgtatactgtggggctggcgtgcagaaagagcatgaagagtacatgaagaatcttctcaaagtgggagggatccttgtcatgccactggaagagaagttgactaagataacacgcacaggtccttcagcttgggaaaccaaaaagattcttgctgtttcttttgctcctctgatccagccctgccattcagagtcaggaaaatcaagacttgtccagttaccaccagtggcagttcgcagcctccaggacttggctcgcatcgccatccggggcaccattaaaaagattattcatcaggaaactgtgagcaaaaacggaaacggactaaagaacacccccaggtttaaacgaaggagagttcgccgccgtcgaatggaaacgattgtctttttggacaaagaagtctttgccagtcggatttccaacccctcagatgacaacagctgtgaagacttggaagaggaacggagggaagaagaagagaagaccccgccggaaacaaagccagaccccccagtgaacttcctacgccagaaggtcctgagcctccctctgccagatcccctgaaatactacttgctttattacagagaaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 12 (sodium/potassium/chloride transporters), member 1
- solute carrier family 22 (organic cation/carnitine transporter), member 16
- solute carrier family 2 (facilitated glucose/fructose transporter), member 5
- protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2

Buy PCMTD2-protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 Gene now

Add to cart