SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene View larger

SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022514
Product type: DNA & cDNA
Ncbi symbol: SPINK2
Origin species: Human
Product name: SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene
Size: 2ug
Accessions: BC022514
Gene id: 6691
Gene description: serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor)
Synonyms: HUSI-II; serine protease inhibitor Kazal-type 2; epididymis tissue protein Li 172; serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor); serine peptidase inhibitor, Kazal type 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgctgtcggtgctgcgcttggcgctgctgctcctggcagttaccttcgcagcctctctgatccctcaatttggtctgttttcaaaatatagaacgccaaactgctctcagtatagattaccaggatgtcccagacactttaaccctgtgtgtggcagtgacatgtccacttatgccaatgaatgtactctgtgcatgaaaatcagggaaggtggtcataatattaaaatcattcgaaatggaccctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
- cytochrome P450, family 2, subfamily B, polypeptide 7 pseudogene 1
- protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)
- major histocompatibility complex, class II, DP beta 2 (pseudogene)

Buy SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene now

Add to cart