Cart 10 Product Products 2 401,83 € (empty)
-
1 x CCDC67-coi...121,50 € -
-
1 x LOC554202-...113,40 € -
-
-
-
1 x HEYL-hairy...121,50 € -
-
-
No products
To be determined Shipping
2 401,83 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 401,83 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 401,83 €
View larger 
SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene
PTXBC022514
New product
Data sheet of SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022514 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SPINK2 |
| Origin species: | Human |
| Product name: | SPINK2-serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) Gene |
| Size: | 2ug |
| Accessions: | BC022514 |
| Gene id: | 6691 |
| Gene description: | serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor) |
| Synonyms: | HUSI-II; serine protease inhibitor Kazal-type 2; epididymis tissue protein Li 172; serine peptidase inhibitor, Kazal type 2 (acrosin-trypsin inhibitor); serine peptidase inhibitor, Kazal type 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgctgtcggtgctgcgcttggcgctgctgctcctggcagttaccttcgcagcctctctgatccctcaatttggtctgttttcaaaatatagaacgccaaactgctctcagtatagattaccaggatgtcccagacactttaaccctgtgtgtggcagtgacatgtccacttatgccaatgaatgtactctgtgcatgaaaatcagggaaggtggtcataatattaaaatcattcgaaatggaccctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits - cytochrome P450, family 2, subfamily B, polypeptide 7 pseudogene 1 - protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched) - major histocompatibility complex, class II, DP beta 2 (pseudogene) |