Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene
PTXBC002779
New product
Data sheet of GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002779 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNPTAB |
| Origin species: | Human |
| Product name: | GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene |
| Size: | 2ug |
| Accessions: | BC002779 |
| Gene id: | 79158 |
| Gene description: | N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits |
| Synonyms: | stealth protein GNPTAB; ICD; N-acetylglucosamine-1-phosphotransferase subunits alpha/beta; GlcNAc phosphotransferase; UDP-N-acetylglucosamine-1-phosphotransferase subunits alpha/beta; UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosamine; glcNAc-1-phosphotransferase subunits alpha/beta; glucosamine (UDP-N-acetyl)-lysosomal-enzyme N-acetylglucosamine phosphotransferase; N-acetylglucosamine-1-phosphate transferase alpha and beta subunits |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgttcaagctcctacagagacagacctatacctgcctgtcccacaggtatgggctctacgtgtgcttcttgggcgtcgttgtcaccatcgtctccgccttccagttcggagaggtggttctggaatggagccgagatcaataccatgttttgtttgattcctatagagacaatattgctggaaagtcctttcagaatcggtctgtgaggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome P450, family 2, subfamily B, polypeptide 7 pseudogene 1 - protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched) - major histocompatibility complex, class II, DP beta 2 (pseudogene) - solute carrier family 6 (neutral amino acid transporter), member 15 |