GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene View larger

GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene

PTXBC002779

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002779
Product type: DNA & cDNA
Ncbi symbol: GNPTAB
Origin species: Human
Product name: GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene
Size: 2ug
Accessions: BC002779
Gene id: 79158
Gene description: N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits
Synonyms: stealth protein GNPTAB; ICD; N-acetylglucosamine-1-phosphotransferase subunits alpha/beta; GlcNAc phosphotransferase; UDP-N-acetylglucosamine-1-phosphotransferase subunits alpha/beta; UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosamine; glcNAc-1-phosphotransferase subunits alpha/beta; glucosamine (UDP-N-acetyl)-lysosomal-enzyme N-acetylglucosamine phosphotransferase; N-acetylglucosamine-1-phosphate transferase alpha and beta subunits
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgttcaagctcctacagagacagacctatacctgcctgtcccacaggtatgggctctacgtgtgcttcttgggcgtcgttgtcaccatcgtctccgccttccagttcggagaggtggttctggaatggagccgagatcaataccatgttttgtttgattcctatagagacaatattgctggaaagtcctttcagaatcggtctgtgaggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome P450, family 2, subfamily B, polypeptide 7 pseudogene 1
- protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)
- major histocompatibility complex, class II, DP beta 2 (pseudogene)
- solute carrier family 6 (neutral amino acid transporter), member 15

Buy GNPTAB-N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits Gene now

Add to cart