TPX2-TPX2, microtubule-associated, homolog (Xenopus laevis) Gene View larger

TPX2-TPX2, microtubule-associated, homolog (Xenopus laevis) Gene


New product

Data sheet of TPX2-TPX2, microtubule-associated, homolog (Xenopus laevis) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TPX2-TPX2, microtubule-associated, homolog (Xenopus laevis) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004136
Product type: DNA & cDNA
Ncbi symbol: TPX2
Origin species: Human
Product name: TPX2-TPX2, microtubule-associated, homolog (Xenopus laevis) Gene
Size: 2ug
Accessions: BC004136
Gene id: 22974
Gene description: TPX2, microtubule-associated, homolog (Xenopus laevis)
Synonyms: TPX2, microtubule nucleation factor; TPX2, microtubule-associated, homolog; TPX2, microtubule-associated protein homolog; C20orf1; C20orf2; DIL-2; DIL2; FLS353; GD:C20orf1; HCA519; HCTP4; REPP86; p100; targeting protein for Xklp2; differentially expressed in cancerous and non-cancerous lung cells 2; differentially expressed in lung cells; hepatocellular carcinoma-associated antigen 519; hepatocellular carcinoma-associated antigen 90; preferentially expressed in colorectal cancer; protein fls353; restricted expression proliferation associated protein 100
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcacaagttaaaagctcttattcctatgatgccccctcggatttcatcaatttttcatccttggatgatgaaggagatactcaaaacatagattcatggtttgaggagaaggccaatttggagaataagttactggggaagaatggaactggagggctttttcagggcaaaactcctttgagaaaggctaatcttcagcaagctattgtcacacctttgaaaccagttgacaacacttactacaaagaggcagaaaaagaaaatcttgtggaacaatccattccgtcaaatgcttgttcttccctggaagttgaggcagccatatcaagaaaaactccagcccagcctcagagaagatctcttaggctttctgctcagaaggatttggaacagaaagaaaagcatcatgtaaaaatgaaagccaagagatgtgccactcctgtaatcatcgatgaaattctaccctctaagaaaatgaaagtttctaacaacaaaaagaagccagaggaagaaggcagtgctcatcaagatactgctgaaaagaatgcatcttccccagagaaagccaagggtagacatactgtgccttgtatgccacctgcaaagcagaagtttctaaaaagtactgaggagcaagagctggagaagagtatgaaaatgcagcaagaggtggtggagatgcggaaaaagaatgaagaattcaagaaacttgctctggctggaatagggcaacctgtgaagaaatcagtgagccaggtcaccaaatcagttgacttccacttccgcacagatgagcgaatcaaacaacatcctaagaaccaggaggaatataaggaagtgaactttacatctgaactacgaaagcatccttcatctcctgcccgagtgactaagggatgtaccattgttaagcctttcaacctgtcccaaggaaagaaaagaacatttgatgaaacagtttctacatatgtgccccttgcacagcaagttgaagacttccataaacgaacccctaacagatatcatttgaggagcaagaaggatgatattaacctgttaccctccaaatcttctgtgaccaagatttgcagagacccacagactcctgtactgcaaaccaaacaccgtgcacgggctgtgacctgcaaaagtacagcagagctggaggctgaggagctcgagaaattgcaacaatacaaattcaaagcacgtgaacttgatcccagaatacttgaaggtgggcccatcttgcccaagaaaccacctgtgaaaccacccaccgagcctattggctttgatttggaaattgagaaaagaatccaggagcgagaatcaaagaagaaaacagaggatgaacactttgaatttcattccagaccttgccctactaagattttggaagatgttgtgggtgttcctgaaaagaaggtacttccaatcaccgtccccaagtcaccagcctttgcattgaagaacagaattcgaatgcccaccaaagaagatgaggaagaggacgaaccggtagtgataaaagctcaacctgtgccacattatggggtgccttttaagccccaaatcccagaggcaagaactgtggaaatatgccctttctcgtttgattctcgagacaaagaacgtcagttacagaaggagaagaaaataaaagaactgcagaaaggggaggtgcccaagttcaaggcacttcccttgcctcattttgacaccattaacctgccagagaagaaggtaaagaatgtgacccagattgaacctttctgcttggagactgacagaagaggtgctctgaaggcacagacttggaagcaccagctggaagaagaactgagacagcagaaagaagcagcttgtttcaaggctcgtccaaacaccgtcatctctcaggagccctttgttcccaagaaagagaagaaatcagttgctgagggcctttctggttctctagttcaggaaccttttcagctggctactgagaagagagccaaagagcggcaggagctggagaagagaatggctgaggtagaagcccagaaagcccagcagttggaggaggccagactacaggaggaagagcagaaaaaagaggagctggccaggctacggagagaactggtgcataaggcaaatccaatacgcaagtaccagggtctggagataaagtcaagtgaccagcctctgactgtgcctgtatctcccaaattctccactcgattccactgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - basic leucine zipper transcription factor, ATF-like 2
- eukaryotic translation initiation factor 3, subunit G
- guanine nucleotide binding protein (G protein), beta 5
- TRM1 tRNA methyltransferase 1 homolog (S. cerevisiae)