APPBP2-amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene View larger

APPBP2-amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene


New product

Data sheet of APPBP2-amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APPBP2-amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018121
Product type: DNA & cDNA
Ncbi symbol: APPBP2
Origin species: Human
Product name: APPBP2-amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene
Size: 2ug
Accessions: BC018121
Gene id: 10513
Gene description: amyloid beta precursor protein (cytoplasmic tail) binding protein 2
Synonyms: APP-BP2; HS.84084; PAT1; amyloid protein-binding protein 2; amyloid beta precursor protein (cytoplasmic tail) binding protein 2; protein interacting with APP tail 1; amyloid beta precursor protein binding protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggccgtggaactagagtggatcccagagactctctataacaccgccatctccgctgtcgtggacaactacatccgctcccgccgagacatccgctccttgcccgagaacatccagtttgatgtttactacaagctttaccaacagggacgcttatgtcaactgggcagtgaattttgtgaattggaagtttttgctaaagtactgagagctttggataaaagacatttgcttcatcattgttttcaggctttgatggatcatggtgttaaagttgcttcagtcttggcctactcattcagtaggcggtgctcttatatagcagaatcagatgctgcagtaaaggaaaaagccattcaggttggctttgttttaggtggctttctttcagatgcaggctggtacagtgatgctgagaaagtttttctgtcctgccttcagttgtgtactctacacgatgagatgcttcattggtttcgtgcagtagaatgttgtgtgaggttgcttcatgtgcgaaatggaaactgcaaatatcatttgggtgaagaaacatttaaattagctcagacatatatggataaactatcaaaacatggccagcaagcaaataaagctgcactctatggagaactgtgtgcactcctatttgcaaaaagtcactatgatgaggcatacaaatggtgcatcgaggcaatgaaagaaattacagcaggcttaccagtgaaagttgtggtggatgtcttaagacaagcttctaaggcttgtgtagtaaaacgtgaatttaagaaggcagaacagttaattaaacatgcagtgtatttggcacgggatcattttggatccaaacacccaaaatattctgatacactgctagattatgggttctacttactcaatgtagataatatctgtcagtctgttgcaatttatcaggcagcccttgacattagacagtcagtgtttggtggcaaaaatatccacgtagcaacagctcatgaagatttggcctactcttcttatgtccaccagtatagctctgggaaatttgacaatgcactatttcatgcagaaagagctattggtatcattacccacatcctacctgaagatcatcttcttttggcttcttcaaagagggtgaaagcacttattttagaggagattgcaattgattgtcataataaggaaactgaacagaggctgcttcaagaagctcatgatttgcacctgtcttcactccaactagctaaaaaagcttttggggaatttaatgtacagactgcaaaacactatggaaaccttggaagactttatcagtcaatgagaaaatttaaggaagctgaagaaatgcacatcaaagcaattcagattaaagaacaacttcttggtcaagaagattatgaagtagccctttcagtgggacatctggcttctttatataattatgacatgaatcagtatgaaaatgctgagaaactttatttgcgatctatagcaattgggaagaaactttttggtgagggctacagtggactagaatatgattatcgaggtctcattaaactttacaactccattggaaattacgagaaagtgtttgaatatcacaatgttctgtctaactggaaccggttgcgagatcggcaatattcagtgacagatgctcttgaagatgtcagcaccagcccccagtccactgaagaagtggtgcagtccttcctgatttctcagaatgtcgagggaccgagctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12
- serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
- guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1

Buy APPBP2-amyloid beta precursor protein (cytoplasmic tail) binding protein 2 Gene now

Add to cart