Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of ZNF44-zinc finger protein 44 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZNF44-zinc finger protein 44 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001868 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZNF44 |
| Origin species: | Human |
| Product name: | ZNF44-zinc finger protein 44 Gene |
| Size: | 2ug |
| Accessions: | BC001868 |
| Gene id: | 51710 |
| Gene description: | zinc finger protein 44 |
| Synonyms: | GIOT-2; KOX7; ZNF; ZNF504; ZNF55; ZNF58; zinc finger protein 44; gonadotropin inducible transcription repressor-2; gonadotropin-inducible ovary transcription repressor 2; zinc finger protein 55; zinc finger protein 58; zinc finger protein KOX7; zinc finger protein ZnFP12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctgtgttatggaactttctggggctaccctaagatgctggaagctgccaatctcatggagggcctagtggatatcggcccttgggtcactcttcccagaggacagcctgaggtgttggagtggggcctcccaaaggatcaggctggagaacttgggacagtggataagtctggtctgttcctgttatctggacttggcagattaatgcaacattctgtgggactttgcaatagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - death-associated protein - hypoxia up-regulated 1 - TP53RK binding protein - zinc finger protein 92 |