Cart 1 Product Products 199,00 € (empty)
No products
To be determined Shipping
199,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 199,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 199,00 €
Data sheet of DAP-death-associated protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DAP-death-associated protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002726 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DAP |
| Origin species: | Human |
| Product name: | DAP-death-associated protein Gene |
| Size: | 2ug |
| Accessions: | BC002726 |
| Gene id: | 1611 |
| Gene description: | death-associated protein |
| Synonyms: | DAP-1; death-associated protein 1; death associated protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcttcgcctcccgaagggaaactagagactaaagctggacacccgcccgccgtgaaagctggtggaatgcgaattgtgcagaaacacccacatacaggagacaccaaagaagagaaagacaaggatgaccaggaatgggaaagccccagtccacctaaacccactgtgttcatctctggggtcatcgcccggggtgacaaagatttccccccggcggctgcgcaggtggctcaccagaagccgcatgcctccatggacaagcatccttccccaagaacccagcacatccagcagccacgcaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypoxia up-regulated 1 - TP53RK binding protein - zinc finger protein 92 - AP2 associated kinase 1 |