Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HYOU1-hypoxia up-regulated 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HYOU1-hypoxia up-regulated 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004560 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HYOU1 |
| Origin species: | Human |
| Product name: | HYOU1-hypoxia up-regulated 1 Gene |
| Size: | 2ug |
| Accessions: | BC004560 |
| Gene id: | 10525 |
| Gene description: | hypoxia up-regulated 1 |
| Synonyms: | GRP-170; Grp170; HSP12A; ORP-150; ORP150; hypoxia up-regulated protein 1; 150 kDa oxygen-regulated protein; 170 kDa glucose-regulated protein; oxygen regulated protein (150kD); hypoxia up-regulated 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagacaaagttaggaggcagaggccgaggaggcgagtctgttgggccttggtggctgtgctcttggcagacctgttggcactgagtgatacactggcagtgatgtctgtggacctgggcagtgagtccatgaaggtggccattgtcaaacctggagtgcccatggaaattgtcttgaataaggaatctcggaggaaaacaccggtgatcgtgaccctgaaagaaaatgaaagattctttggagacagtgcagcaagcatggcgattaagaatccaaaggctacgctacgttacttccagcacctcctggggaagcaggcagataacccccatgtagctctttaccaggcccgcttcccggagcacgagctgactttcgacccacagaggcagactgtgcactttcagatcagctcgcagctgcagttctcacccctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TP53RK binding protein - zinc finger protein 92 - AP2 associated kinase 1 - mutY homolog (E. coli) |