Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ID3-inhibitor of DNA binding 3, dominant negative helix-loop-helix protein Gene
PTXBC003107
New product
Data sheet of ID3-inhibitor of DNA binding 3, dominant negative helix-loop-helix protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ID3-inhibitor of DNA binding 3, dominant negative helix-loop-helix protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003107 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ID3 |
| Origin species: | Human |
| Product name: | ID3-inhibitor of DNA binding 3, dominant negative helix-loop-helix protein Gene |
| Size: | 2ug |
| Accessions: | BC003107 |
| Gene id: | 3399 |
| Gene description: | inhibitor of DNA binding 3, dominant negative helix-loop-helix protein |
| Synonyms: | HEIR-1; bHLHb25; DNA-binding protein inhibitor ID-3; ID-like protein inhibitor HLH 1R21; class B basic helix-loop-helix protein 25; helix-loop-helix protein HEIR-1; inhibitor of DNA binding 3, dominant negative helix-loop-helix protein; inhibitor of differentiation 3; inhibitor of DNA binding 3, HLH protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggcgctgagcccggtgcgcggctgctacgaggcggtgtgctgcctgtcggaacgcagtctggccatcgcccggggccgagggaagggcccggcagctgaggagccgctgagcttgctggacgacatgaaccactgctactcccgcctgcgggaactggtacccggagtcccgagaggcactcagcttagccaggtggaaatcctacagcgcgtcatcgactacattctcgacctgcaggtagtcctggccgagccagcccctggaccccctgatggcccccaccttcccatccagacagccgagctcgctccggaacttgtcatctccaacgacaaaaggagcttttgccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - amyloid beta precursor protein (cytoplasmic tail) binding protein 2 - processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12 - serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 |