Login to display prices
Login to display prices
ACP1-acid phosphatase 1, soluble Gene View larger

ACP1-acid phosphatase 1, soluble Gene

PTXBC007422

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACP1-acid phosphatase 1, soluble Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ACP1-acid phosphatase 1, soluble Gene

Proteogenix catalog: PTXBC007422
Ncbi symbol: ACP1
Product name: ACP1-acid phosphatase 1, soluble Gene
Size: 2ug
Accessions: BC007422
Gene id: 52
Gene description: acid phosphatase 1, soluble
Synonyms: HAAP; LMW-PTP; LMWPTP; low molecular weight phosphotyrosine protein phosphatase; LMW-PTPase; acid phosphatase of erythrocyte; adipocyte acid phosphatase; cytoplasmic phosphotyrosyl protein phosphatase; low molecular weight cytosolic acid phosphatase; Protein-tyrosine-phosphatase; red cell acid phosphatase 1; testicular secretory protein Li 37; acid phosphatase 1, soluble
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggaacaggctaccaagtccgtgctgtttgtgtgtctgggtaacatttgtcgatcacccattgcagaagcagttttcaggaaacttgtaaccgatcaaaacatctcagagaattgggtcattgacagcggtgctgtttctgactggaacgtgggccggtccccagacccaagagctgtgagctgcctaagaaatcatggcattcacacagcccataaagcaagacagattaccaaagaagattttgccacatttgattatatactatgtatggatgaaagcaatctgagagatttgaatagaaaaagtaatcaagttaaaacctgcaaagctaaaattgaactacttgggagctatgatccacaaaaacaacttattattgaagatccctattatgggaatgactctgactttgagacggtgtaccagcagtgtgtcaggtgctgcagagcgttcttggagaaggcccactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: