No products
Prices are tax excluded
PTXBC007422
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007422 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACP1 |
| Origin species: | Human |
| Product name: | ACP1-acid phosphatase 1, soluble Gene |
| Size: | 2ug |
| Accessions: | BC007422 |
| Gene id: | 52 |
| Gene description: | acid phosphatase 1, soluble |
| Synonyms: | HAAP; LMW-PTP; LMWPTP; low molecular weight phosphotyrosine protein phosphatase; LMW-PTPase; acid phosphatase of erythrocyte; adipocyte acid phosphatase; cytoplasmic phosphotyrosyl protein phosphatase; low molecular weight cytosolic acid phosphatase; Protein-tyrosine-phosphatase; red cell acid phosphatase 1; testicular secretory protein Li 37; acid phosphatase 1, soluble |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaacaggctaccaagtccgtgctgtttgtgtgtctgggtaacatttgtcgatcacccattgcagaagcagttttcaggaaacttgtaaccgatcaaaacatctcagagaattgggtcattgacagcggtgctgtttctgactggaacgtgggccggtccccagacccaagagctgtgagctgcctaagaaatcatggcattcacacagcccataaagcaagacagattaccaaagaagattttgccacatttgattatatactatgtatggatgaaagcaatctgagagatttgaatagaaaaagtaatcaagttaaaacctgcaaagctaaaattgaactacttgggagctatgatccacaaaaacaacttattattgaagatccctattatgggaatgactctgactttgagacggtgtaccagcagtgtgtcaggtgctgcagagcgttcttggagaaggcccactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - heat shock 22kDa protein 8 - regulator of calcineurin 1 - nuclear RNA export factor 1 - nuclear RNA export factor 2 |