PTXBC007422
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC007422 |
Product type: | DNA & cDNA |
Ncbi symbol: | ACP1 |
Origin species: | Human |
Product name: | ACP1-acid phosphatase 1, soluble Gene |
Size: | 2ug |
Accessions: | BC007422 |
Gene id: | 52 |
Gene description: | acid phosphatase 1, soluble |
Synonyms: | HAAP; LMW-PTP; LMWPTP; low molecular weight phosphotyrosine protein phosphatase; LMW-PTPase; acid phosphatase of erythrocyte; adipocyte acid phosphatase; cytoplasmic phosphotyrosyl protein phosphatase; low molecular weight cytosolic acid phosphatase; Protein-tyrosine-phosphatase; red cell acid phosphatase 1; testicular secretory protein Li 37; acid phosphatase 1, soluble |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcggaacaggctaccaagtccgtgctgtttgtgtgtctgggtaacatttgtcgatcacccattgcagaagcagttttcaggaaacttgtaaccgatcaaaacatctcagagaattgggtcattgacagcggtgctgtttctgactggaacgtgggccggtccccagacccaagagctgtgagctgcctaagaaatcatggcattcacacagcccataaagcaagacagattaccaaagaagattttgccacatttgattatatactatgtatggatgaaagcaatctgagagatttgaatagaaaaagtaatcaagttaaaacctgcaaagctaaaattgaactacttgggagctatgatccacaaaaacaacttattattgaagatccctattatgggaatgactctgactttgagacggtgtaccagcagtgtgtcaggtgctgcagagcgttcttggagaaggcccactga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - heat shock 22kDa protein 8 - regulator of calcineurin 1 - nuclear RNA export factor 1 - nuclear RNA export factor 2 |