Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HSPB8-heat shock 22kDa protein 8 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HSPB8-heat shock 22kDa protein 8 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002673 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HSPB8 |
| Origin species: | Human |
| Product name: | HSPB8-heat shock 22kDa protein 8 Gene |
| Size: | 2ug |
| Accessions: | BC002673 |
| Gene id: | 26353 |
| Gene description: | heat shock 22kDa protein 8 |
| Synonyms: | CMT2L; DHMN2; E2IG1; H11; HMN2; HMN2A; HSP22; heat shock protein beta-8; E2-induced gene 1 protein; alpha-crystallin C chain; heat shock 22kDa protein 8; heat shock 27kDa protein 8; protein kinase H11; small stress protein-like protein HSP22; heat shock protein family B (small) member 8 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgacggtcagatgcccttctcctgccactacccaagccgcctgcgccgagaccccttccgggactctcccctctcctctcgcctgctggatgatggctttggcatggaccccttcccagacgacttgacagcctcttggcccgactgggctctgcctcgtctctcctccgcctggccaggcaccctaaggtcgggcatggtgccccggggccccactgccaccgccaggtttggggtgcctgccgagggcaggacccccccacccttccctggggagccctggaaagtgtgtgtgaatgtgcacagcttcaagccagaggagttgatggtgaagaccaaagatggatacgtggaggtgtctggcaaacatgaagagaaacagcaagaaggtggcattgtttctaagaacttcacaaagaaaatccagcttcctgcagaggtggatcctgtgacagtatttgcctcactttccccagagggtctgctgatcatcgaagctccccaggtccctccttactcaacatttggagagagcagtttcaacaacgagcttccccaggacagccaggaagtcacctgtacctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulator of calcineurin 1 - nuclear RNA export factor 1 - nuclear RNA export factor 2 - SECIS binding protein 2 |